Mg132

The interaction of RNF183 and DR5: HEK293 cells stably expressing FLAG-tagged RNF183 were lysed in lysis buffer [20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 10% glycerol, 1% Triton X-100, 100 μM MG132 (FUJIFILM Wako Pure Chemical), Protease inhibitor cocktail Set V (EDTA free; FUJIFILM Wako Pure Chemical) on ice for 20 min. Supernatants were incubated with an anti-FLAG antibody at 4 °C for 1 h, and followed by incubation with Protein G Agarose Beads (Thermo Fisher Scientific) for 1 h; subsequently, the beads were rinsed three times with a wash buffer [20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 10% glycerol, 0.1% Triton X-100]. Immunoprecipitates were boiled with Laemmli sodium dodecyl sulphate polyacrylamide gel electrophoresis sample buffer and analysed by western blotting.
The ubiquitination of DR5:HEK293 cells stably expressing V5-tagged RNF183 were lysed in lysis buffer containing 20 µM MG132, 1 mM N-ethylmaleimide (FUJIFILM Wako Pure Chemical), 5 mM EDTA on ice for 20 min, and then quenched with 0.1% cysteine. Supernatants were incubated with anti-DR5 antibody at 4 °C for 1 h, followed by incubation with Protein G Agarose Beads for 1 h; the beads were rinsed with the same wash buffer.

HEK293 cells with stable expressions of RNF183, RNF152, or HRD1 were transfected with short interfering RNA (siRNA) against Sec16A (CCAGGUGUUUAAGUUCAUCUA) using ScreenFect siRNA (Wako Pure Chemical Industries). At 44 h post-transfection, cells were incubated with 30 μg/ml cycloheximide (Wako Pure Chemical Industries) and 10 μM MG-132 (Wako Pure Chemical Industries) for 0, 1, 2, or 4 h and were subsequently harvested. Proteins were extracted using lysis buffer [20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 10% glycerol, 1% Triton X-100, 100 μM MG-132, Protease inhibitor cocktail Set V (Wako Pure Chemical Industries)]. The lysates were boiled with Laemmli SDS-PAGE sample buffer and subjected to Western blotting using a WSE-6100 LuminoGraph (ATTO Corporation, Tokyo, Japan).

The cells (2.0 × 10⁵ cells/well) were seeded in a six-well plate. The cells were pre-incubated under normoxic or hypoxic conditions for 16 h, or normoxic with MG132 (50 μM) (Wako, Tokyo, Japan) treatment for 4 h. Then, POL probe (final concentration of 100 nM) was added to the culture medium and the cells were incubated for 30 min under the same conditions as preincubation. The cells were then washed with fresh medium and further incubated for 1 h under the same conditions. Total cell lysates were electrophoresed on a 12.5% SDS-polyacryl-amide gel and transferred to a Hybond ECL membrane (GE Healthcare). The membrane was treated with primary antibodies such as monoclonal anti-HIF-1α antibody (R&D systems, Abingdon, UK), polyclonal anti-HIF-2α antibody (Novus Biologicals, Litteleton, CO, USA), polyclonal anti-Renilla luciferase antibody (Biocompare, South San Francisco, CA, USA), polyclonal anti-pVHL antibody (Cell Signaling Technology, Beverly, MA, USA), monoclonal anti-actin antibody (Sigma, St. Louis, MO, USA). The primary antibodies bound to their targets on the membrane were then probed using appropriate secondary antibodies conjugated with horseradish peroxidase (GE Healthcare) and chemiluminescent Chemi-Lumi One system (Nacalai Tesque).