Sybr green supermix

Manufactured by Toyobo

Sourced in Japan, United States

SYBR Green Supermix is a ready-to-use solution for real-time PCR applications. It contains SYBR Green I dye, DNA polymerase, dNTPs, and necessary buffers and salts for efficient amplification and detection of target DNA sequences.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

SYBR Green (204 citations) SYBR Green Supermix kit (8 citations) ITaq Universal SYBR Green Supermix Kit (6 citations) SYBR Green qPCR SuperMix (2 citations) SYBR Green PCR Supermix (2 citations)

26 protocols using sybr green supermix

Quantitative PCR Analysis of Rumen Microbiome

Check if the same lab product or an alternative is used in the 5 most similar protocols

Samples were placed in screw-capped tubes containing silica beads for DNA extraction with a high-speed reciprocal shaker, following a modified bead-beating protocol with a Soil kit (Macherey-nagel, Düren, Germany). Briefly, a 1.0-mL aliquot of the incubated culture solution was centrifuged at 3,000×rpm, and then placed in a NanoDrop Spectrophotometer (Thermo Scientific, Wilmington, DE, USA) to determine nucleic acid concentrations.
Previous reports provided primers and thermocycling protocols used for amplification of general bacteria [13 (link)], ciliate protozoa [14 (link)], methanogenic archaea [15 (link)], Fibrobacter succinogenes (F. succinogenes) [13 (link)], Ruminococcus albus (R. albus)[16 ] and Ruminococcus flavefaciens (R. flavefaciens) [13 (link)].
Quantitative real-time polymerase chain reaction (qPCR) assays (CFX96 Real-Time system; Bio Rad, USA) using the SYBR Green Supermix (QPK-201, Toyobo Co., LTD., Tokyo, Japan) were performed following previously described methods (Denman and McSweeney [13 (link)] and Denman et al [15 (link)]). Microbial abundance was expressed with the following equation: relative quantification = 2^{−ΔCt(Target)−ΔCt(Control)}, where Ct represents threshold cycle. The qPCR reaction mixtures (20 μL) contained forward/ reverse primers, SYBR Green Supermix and DNA template.

Lee S.J., Shin N.H., Jeong J.S., Kim E.T., Lee S.K, & Lee S.S. (2017). Effect of Rhodophyta extracts on in vitro ruminal fermentation characteristics, methanogenesis and microbial populations. Asian-Australasian Journal of Animal Sciences, 31(1), 54-62.

+ Open protocol

+ Expand

Quantifying PEDV, IL-1β, and IL-6 Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were harvested, and total RNA was extracted with Trizol (Invitrogen). The RNA was reverse-transcribed into complementary DNA (cDNA). A two-step RT-PCR (SYBR Green I technology, Applied Roche) was performed using SYBR green super mix (Toyobo) according to the manufacturer’s protocol to measure transcription levels for several genes of interest. The primers used were as follows: PEDV-N: 5′- CTG GGT TGC TAA AGA AGG CG − 3′ (forward), 5′- CTG GGG AGC TGT TGA GAG AA − 3′ (reverse). IL-1β: 5′- GAC CTG GAC CTC TGC CCT CTG-3′ (forward), 5′- AGG TAT TTT GTC ATT ACT TTC-3′ (reverse). IL-6: 5′- AAC TCC TTC TCC ACA AGC − 3′ (forward), 5′- TGG ACT GCA GGA ACT CCT − 3′ (reverse). GAPDH: 5′-GAT CAT CAG CAA TGC CTC CT − 3′ (forward), 5′- TGA GTC CTT CCA CGA TAC CA − 3′ (reverse).
Relative fold changes were automatically calculated by the Step One Plus real-time PCR system software (Applied Bio systems), following the 2^-∆∆CT method. GAPDH as a control.

Li C.C, & Wang X.J. (2020). Three kinds of treatment with Homoharringtonine, Hydroxychloroquine or shRNA and their combination against coronavirus PEDV in vitro. Virology Journal, 17, 71.

+ Open protocol

+ Expand

Quantitative Analysis of C. jejuni Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols

C. jejuni 81–176 wild-type were grown under microaerobic and aerobic conditions, separately, and harvested during the mid-exponential phase. RNA extraction was performed using Trizol (TaKaRa, Japan) following the manufacturer’s instructions. The purity and concentration of the RNA were determined by gel electrophoresis and a NanoDrop spectrophotometer (Thermo Scientific, USA). RNA was transcribed using the cDNA master Kit (TOYOBO, Japan). Transcript levels were determined with SYBR Green Supermix (TOYOBO, Japan) in a CFX96 Connect Real-Time PCR Detection System (Bio-Rad). The cycling parameters: 95°C for 30 seconds and 40 cycles of 94°C for 15 seconds and 60°C for 30 seconds. The abundance of the pheX gene was used as an internal standard and the relative expression levels of cheO were calculated using the Quantitation-Comparative CT(2 −ΔΔCT) method [65 (link)].

Mo R., Ma W., Zhou W, & Gao B. (2022). Polar localization of CheO under hypoxia promotes Campylobacter jejuni chemotactic behavior within host. PLOS Pathogens, 18(11), e1010953.

+ Open protocol

+ Expand

qRT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

First, RNA was extracted. Then, using a standard concentration of RNA, single‐stranded RNA was converted to cDNA using the Revert Aid First Strand cDNA Synthesis Kit (Thermo Scientific, Lithuania, K1622) according to the following PCR program: 42°C for 1 h, 72°C for 5 min, and hold at 4°C. qRT‐PCR was performed with the Bio‐Rad CFX96 using the SYBR Green Supermix (Toyobo, QPK201T) with primers for the indicated genes. FP: 5′‐AACTCTGCCGCTAACGTGAA‐3′, RP: 5′‐AAGCCCAGGTTCTTCTGCTC‐3′; for homosapiens actin NM_001101.3, FP: 5′‐CATGTACGTTGCTATCCAGGC‐3′, RP: 5′‐CTCCTTAATGTCACGCACGAT‐3′; for ORF1as(F1), FP: GAAATTAATACGACTCACTATAGGG, RP: GCGGAGTTGATCACAACTACAGCCATAAC; for N fragment (F2), FP: GAAATTAATACGACTCACTATAGGG, RP: CATTTTGCTCTCAAGCTGGTTCAATCTGTC.

Liu Z., Gao X., Kan C., Li L., Zhang Y., Gao Y., Zhang S., Zhou L., Zhao H., Li M., Zhang Z, & Sun Y. (2023). CRISPR‐Cas13d effectively targets SARS‐CoV‐2 variants, including Delta and Omicron, and inhibits viral infection. MedComm, 4(1), e208.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Viral Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Replicated cultures were harvested and total RNA was extracted using Trizol reagent (Invitrogen) according to the manufacturer’s protocol. A two-step RT-PCR (SYBR Green I technology, Applied Roche Diagnostics, Mannheim, Germany) was performed using SYBR green supermix (Toyobo, Osaka, Japan) according to the manufacturer’s protocol to measure transcription levels for several genes of interest. The primers used were as follows: NDV-NP, 5′–TTT TGC TAA CAG TGT GCC CC–3′ (forward), 5′–ATC TTC AAC CCC AGC TGT GA–3′ (reverse); PEDV-N, 5′–CTG GGT TGC TAA AGA AGG CG–3′ (forward), 5′–CTG GGG AGC TGT TGA GAG AA–3′ (reverse); actin, 5′–CGT TGA CAT CCG TAA AGA CC–3′ (forward), 5′–CTA GGA GCC AGA GCA GTA ATC–3′ (reverse); glyceraldehyde 3-phosphate dehydrogenase (GAPDH): 5′–GAT CAT CAG CAA TGC CTC CT–3′ (forward), 5′–TGA GTC CTT CCA CGA TAC CA–3′ (reverse). Relative fold changes were automatically calculated by the Step One Plus real-time PCR system software (Applied Biosystems, Foster City, CA, USA), following the ∆∆C_T method. Actin was also determined and used as internal control.

Dong H.J., Wang Z.H., Meng W., Li C.C., Hu Y.X., Zhou L, & Wang X.J. (2018). The Natural Compound Homoharringtonine Presents Broad Antiviral Activity In Vitro and In Vivo. Viruses, 10(11), 601.

+ Open protocol

+ Expand

Mouse Cardiac Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from mouse left ventricles using TRIzol reagent (T9424, Sigma) according to the manufacturer's recommendations. 0.5 μg of total RNA was reverse‐transcribed into cDNA with PrimeScript Reverse Transcriptase (2680B, Takara). qRT‐PCR was performed by using SYBR Green Supermix (636600, Toyobo) in a Thermo QuantStudio 6 Flex Real‐Time PCR system. Gene expression was determined relative to Gapdh using the log₂ fold change method. All qRT‐PCR primers covered exon‐exon junctions when possible. Primer sequences for qRT‐PCR are listed in Table S1.

Gao S., Sun H., Chen K., Gu X., Chen H., Jiang L., Chen L., Zhang S., Liu Y., Shi D., Liang D., Xu L., Yang J., Ruan Y., Chen H., Shen B., Ma H, & Chen Y. (2021). Depletion of m6A reader protein YTHDC1 induces dilated cardiomyopathy by abnormal splicing of Titin. Journal of Cellular and Molecular Medicine, 25(23), 10879-10891.

+ Open protocol

+ Expand

Quantitative analysis of dopaminergic genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from WT and Ewsr1 KO mice was extracted by using a commercial extraction system (Macherey-Nagel). 500 ng RNA was prepared for cDNA synthesis, using a First strands cDNA Synthesis Kit (Toyobo, Osaka, Japan). The amplification of cDNA from each sample was performed by RT-PCR, using SYBR Green Supermix (Toyobo, Osaka, Japan). PCR cycling conditions were as the following: denaturation for 3 min at 95℃, then 40 cycles of amplification for 15 s at 95℃, 15 s at 60℃, 20 s at 70℃, followed with 30 s at 72℃. The PCR primers were: mouse Th: forward, F: 5'-GATTGCAGAGATTGCCTTCC-3' and reverse, R: 5'-GAAGTGAGACACATCCTCCA-3'; mouse DARPP-32 : forward, 5'-CCCAGCCTTAACCCAGTACTGTTC-3' and reverse, 5'-TGGGCAAGTGGACTGTTCAGAT-3'; mouse Ddc: forward, 5'-TACCCAGCTATGCTTGCAGAC-3' and reverse, 5'-GCGGATAACTTTAGTCCGAGC-3'; mouse Gapdh: forward, 5'-ACC ACA GTC CAT GCC ATC AC-3' and reverse, 5'-TCC ACC ACC CTG TTG CTG T-3'. Gapdh mRNA was used as a control. The mRNA of each sample was normalized to Gapdh mRNA.

Yoon Y., Park H., Kim S., Nguyen P.T., Hyeon S.J., Chung S., Im H., Lee J., Lee S.B, & Ryu H. (2018). Genetic Ablation of EWS RNA Binding Protein 1 (EWSR1) Leads to Neuroanatomical Changes and Motor Dysfunction in Mice. Experimental Neurobiology, 27(2), 103-111.

+ Open protocol

+ Expand

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Extraction of Total RNA was extracted using the RNAfast200 kit (Fastagen, Shanghai, China). Complementary DNA (cDNA) was synthesised using a reverse transcription kit (Toyobo, Osaka, Japan) according to the manufacturer’s instructions. RT-qPCR was then executed in Bio-Rad IQ 5 system (Bio-Rad) using the SYBR Green Supermix (Toyobo, Osaka, Japan). The primers used include the following: MTFR1 (F, 5′-TGCAACAGAATGGAGTCCCA-3′ and R, 5′-AAGGGGTGGCCTTGATCTGA-3′); GAPDH (F, 5′-GCACCGTCAAGGCTGAGAAC-3′ and R, 5′-TGGTGAAGACGCCAGTGGA-3′); miR-29c-3p (F, 5′-CTCCTCCTTTTAGCACCATTTG-3′ and R, 5′-TATGCTTGTTCTCGTCTCTGTGTC-3′) and U6 (F, 5′-CAGCACATATACTAAAATTGGAACG-3′ and R, 5′-ACGAATTTGCGTGTCATCC-3′). U6 and GAPDH were used as internal references, and all the aforementioned primers were obtained from GenePharma Co., Ltd. (Shanghai, China). The experiment was repeated thrice, and data were analysed using the 2^−△△Ct method.

Li Y., Liu Y., Jin K., Dong R., Gao C., Si L., Feng Z., Zhang H, & Tian H. (2021). Negatively Regulated by miR-29c-3p, MTFR1 Promotes the Progression and Glycolysis in Lung Adenocarcinoma via the AMPK/mTOR Signalling Pathway. Frontiers in Cell and Developmental Biology, 9, 771824.

+ Open protocol

+ Expand

Quantitative PCR Enumeration of Microbes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Quantitative PCR assays for enumeration of microbes were performed according to the methods described by Denman and McSweeney (2006) (link) and Denman et al. (2007) (link) on a real-time PCR Machine (CFX96 Real-Time system, BIO RAD, Hercules, CA, USA) using the SYBR Green Supermix (QPK-201, Toyobo Co., LTD., Tokyo, Japan). The values of cycle threshold (Ct) after real-time PCR were used to determine fold change (number of fold difference) of different microbial population relative to control without additives. Abundance of these microbes was expressed by the equation: relative quantification = 2^{−ΔCt(Target)−ΔCt(Control)}, where Ct represents threshold cycle. All quantitative (q) PCR reaction mixtures (final volume of 20 μL) contained forward and reverse primers, the SYBR Green Supermix and DNA template. A negative control without the template DNA was used in every qPCR assay for each primer. The PCR amplification of the target DNA, included the annealing and the extension temperature, was conducted following the references in Table 2.

Kim E.T., Guan L.L., Lee S.J., Lee S.M., Lee S.S., Lee I.D., Lee S.K, & Lee S.S. (2015). Effects of Flavonoid-rich Plant Extracts on In vitro Ruminal Methanogenesis, Microbial Populations and Fermentation Characteristics. Asian-Australasian Journal of Animal Sciences, 28(4), 530-537.

+ Open protocol

+ Expand

RNA Isolation and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions. RNA was analyzed quantitatively using a Nanodrop (Nanodrop Technologies, Rockland, DE, USA). Total RNA (1 μg) was reverse transcribed into cDNA using a cDNA synthesis kit (Toyobo) according to the manufacturer’s instructions. RT-PCR was performed in a Roche LightCycler 2.0 detector with the Toyobo SYBR Green Supermix. The reactions were analyzed using SDS software (Version 2.4). The threshold cycles (CT) were calculated and the relative gene expression was analyzed after normalizing to glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The human primers are listed in Additional file 1: Figure S1.

Zhang C., Zhang X., Xu R., Huang B., Chen A.J., Li C., Wang J, & Li X.G. (2017). TGF-β2 initiates autophagy via Smad and non-Smad pathway to promote glioma cells’ invasion. Journal of Experimental & Clinical Cancer Research : CR, 36, 162.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!