Rapid bacterial genomic dna isolation kit

Manufactured by Sangon

Sourced in China

The Rapid Bacterial Genomic DNA Isolation Kit is a laboratory tool designed for the efficient extraction and purification of genomic DNA from bacterial samples. The kit utilizes a rapid and straightforward protocol to isolate high-quality DNA, which can be used for various downstream applications such as PCR, sequencing, and molecular analysis.

Automatically generated - may contain errors

Lab products found in correlation

Nystatin, by Sangon (2 mentions) Nebnext ultra dna library prep kit for, by Illumina (1 mentions) Phusion master mix, by New England Biolabs (1 mentions) Hiseq 2000 system, by Illumina (1 mentions) Mupirocin, by Sangon (1 mentions) L cysteine hydrochloride, by Sangon (1 mentions) Hiseq 4000 system, by Illumina (1 mentions) Tb green premix ex taq 2 kit, by Takara Bio (1 mentions) Lightcycler 96, by Roche (1 mentions) Sanger sequencing, by Sangon (1 mentions) Axyprep plasmid miniprep kit, by Corning (1 mentions) Rapid sequencing kit sqk rad003, by Oxford Nanopore (1 mentions) Pcr product purification kit, by Sangon (1 mentions) Pacbio rs, by Illumina (1 mentions) Hiseq 2000, by Illumina (1 mentions) Pacbio rs 2 platform, by Pacific Biosciences (1 mentions) Hiseq 2500 sequencer, by Illumina (1 mentions) Hgap v3, by Pacific Biosciences (1 mentions) Restriction enzyme, by Takara Bio (1 mentions) Rapid mini plasmid kit, by Tiangen Biotech (1 mentions)

35 protocols using rapid bacterial genomic dna isolation kit

Isolation and Identification of Lactobacillus from Fecal Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

One hundred and twenty fecal samples were collected from different regions of China. The fecal samples were mixed with 30% sterile glycerin solution (China National Medicines Corp. Ltd., Beijing, China) , stored temporarily at 4°C, and stored at -80°C within 48 h for a maximum of 8 wk. One g of each stool sample was blended with 9 ml sterile physiological saline (China National Medicines Corp.
Ltd.) (Ingham, 1999) . Serial dilution and plating were done in an anaerobic workstation (AW400TG, Electrotek Scientific Ltd., Shipley, West Yorkshire, UK). For selection of lactobacilli, 100 μl of diluent was plated on Lactobacillus selective agar (LBS) (China National Medicines Corp. Ltd.) (Ingham, 1999) , and 50 U/ml nystatin (Sangon Biotech Co., Ltd., Shanghai, China) . Agar plates were cultured in the anaerobic workstation flushed with 80% N 2 , 10% CO 2 and 10% H 2 at 37°C for 72 h. For each sample, colonies on LBS plates were counted. Colonies were selected at random and re-streaked onto LBS agar for purity. The final pure culture was cultured in LBS at 37°C for 24 h and preserved in 30% glycerol (China National Medicines Corp. Ltd.) at -80°C (Bottacini et al., 2018) .
DNA was extracted from each strain using the Rapid Bacterial Genomic DNA Isolation Kit (Sangon Biotech Co., Ltd.) according to the manufacturer's instructions. The identity of each putative

Huang D., Yang B., Chen Y., Stanton C., Ross R.P., Zhao J., Zhang H., & Yang B. (2020). Comparative genomic analyses of Lactobacillus rhamnosus isolated from Chinese subjects. Food Bioscience, 36, 100659-100659.

+ Open protocol

+ Expand

Comprehensive Bacterial Genomic DNA Extraction and Sequencing

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was extracted using a Rapid Bacterial Genomic DNA Isolation Kit (Sangon Biotech, Shanghai, China) according to the manufacturer’s instructions. The concentration and purity of the extracted DNA were determined using a DNA Qubit 2.0 (Invitrogen, Carlsbad, CA, USA). The extracted genomic DNA was used to construct next-generation libraries with an insert size of 500 bp using a NEBNext^® Ultra™ DNA Library Prep Kit for Illumina^® and PacBio RS II libraries with an insert size of 10 kb.
Genome sequencing was conducted by Sangon Biotech Co., Ltd. (Shanghai, China) using the next-generation Illumina MiSeq (Illumina, San Diego, CA, USA) and the third-generation PacBio RS II sequencing platform (Pacific Biosciences, Menlo Park, CA, USA), respectively. The raw sequences obtained from the third-generation PacBio RS II sequencing platform were assembled using Canu (Koren et al., 2016 (link)). Gapcloser and GapFiller were used to close the gaps with next-generation sequence reads where possible after assembly (Boetzer & Pirovano, 2012 (link)) and the sequence variants were detected and assembled by PrInSeS-G to obtain high-quality, whole-genome sequences (Massouras et al., 2010 (link)).

Tu Z., Li H., Zhang X., Sun Y, & Zhou Y. (2017). Complete genome sequence and comparative genomics of the golden pompano (Trachinotus ovatus) pathogen, Vibrio harveyi strain QT520. PeerJ, 5, e4127.

+ Open protocol

+ Expand

Bacterial 16S rRNA Gene Identification

Check if the same lab product or an alternative is used in the 5 most similar protocols

The genomic DNA from the overnight grown isolate was extracted by using the Rapid Bacterial Genomic DNA Isolation Kit from Sangon Biotech Co., Ltd. (Shanghai, China). The 16S rRNA gene was amplified by PCR from the cellulases producing bacteria genomic DNA using primers pairs, 7F (5′-CAGAGTTTGATCCTGGCT-3′) and 1540R (5′-AGGAGGTGTCCAGCCGCA-3′) (Zhang and Nan, 2012 (link)). Amplified products were checked for size and purity on 1% (w/v) agarose gel and were sequenced by Sangon Biotech Co., Ltd. (Shanghai, China). The obtained sequences were aligned using the Basic Local Alignment Search Tool (BLAST) program of NCBI for homology analysis against the Ribosomal database (http://rdp.cme.msu.edu/index.jsp). The nucleotide sequences of the isolate and closely related strains from GenBank were also used for alignment, and a Neighbor-Joining (NJ) phylogenetic tree was built using the MEGA 7.0 program (Kumar et al., 2016 (link)).

Gan Y., Wu Y.J., Dong Y.Q., Li Q., Wu S.G., Jin Y.Q, & Lu T.F. (2023). The study on the impact of sex on the structure of gut microbiota of bamboo rats in China. Frontiers in Microbiology, 14, 1276620.

+ Open protocol

+ Expand

Bacterial 16S rRNA Gene Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA extraction and PCR amplification were referred to the previous study (Liu et al., 2019 (link)) with some minor modifications. DNA was extracted by the Rapid Bacterial Genomic DNA Isolation Kit (Sangon Biotech, Shanghai, China). Using primers 338F and 806R, the bacterial 16S rRNA V3-V4 region was amplified. The bacterial DNA amplification was performed with 30 μL reaction solution, containing 10 ng template DNA, 6 μM primers, 15 μL 2 × Phusion Master Mix (New England BioLabs Inc., Ipswich, MA), and 2 μL H₂O. The reaction condition of PCR was initial denaturation at 98 ℃ for 1 min, denaturation at 98 ℃ for 10 s, annealing at 50 ℃ for 30 s, and extension at 72 ℃ for 30 s. After 30 cycles, it was extended for 5 min at 72 ℃. The PCR amplification products were investigated by 2 % agarose electrophoresis and further purified with the AxyPrep DNA Gel Extraction Kit (AxyPrep Biosciences, Union City, CA, USA). Then, the bacterial 16S rRNA gene was sequenced by pyrophosphate.

Chen H., Liu L., Jiang L., Hu W., Cen Q., Zhang R., Hui F., Li J, & Zeng X. (2024). Effect of L. Plantarum Y279 and W. Cibaria Y113 on microorganism, lipid oxidation and fatty acid metabolites in Yu jiaosuan, A Chinese tradition fermented snack. Food Chemistry: X, 21, 101246.

+ Open protocol

+ Expand

Lactobacillus Genome Sequencing Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

All Lactobacillus strains were cultured in liquid DeMan-Rogosa-Sharpe (MRS) medium (Sinopharm Chemical Reagent Ltd., Shanghai, China) and incubated at 37°C for 12 to 24 h. The bacterial culture was centrifuged at 6,000 rpm for 3 min, and then the supernatant was collected. Next, bacterial cells were washed in 0.9% sterile normal saline and collected by centrifugation under the same conditions. Genomic DNA extraction was performed using the rapid bacterial genomic DNA isolation kit (Sangon Biotech Ltd., Shanghai, China) according to the instruction manual.
Genome sequencing was performed using the Illumina HiSeq× 10 platform (Novogene Biotech Ltd., Tianjin, China; Majorbio Biotech Ltd., Shanghai, China), which generated 2 × 150-bp pair-end read libraries. For each sample, the raw data with no less than 100× genome coverage depth were provided and trimmed into high-quality reads (clean data). The software SOAPdenovo2 (67 (link)) was used to assemble contigs, and then we tested various kmer values and obtained the optimal assembly result. Next, according to the relationship between paired-end reads and read overlaps, the assembly result was partially assembled and optimized to form scaffolds. The quality data of each genome (genome size, GC content, genome level, number of scaffolds, and N₅₀ value) are listed in Table S1A.

Pei Z., Sadiq F.A., Han X., Zhao J., Zhang H., Ross R.P., Lu W, & Chen W. (2021). Comprehensive Scanning of Prophages in Lactobacillus: Distribution, Diversity, Antibiotic Resistance Genes, and Linkages with CRISPR-Cas Systems. mSystems, 6(3), e01211-20.

+ Open protocol

+ Expand

Genome Sequencing and Annotation of E. coli

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total genomic DNA of E. coli isolates was extracted using Rapid Bacterial Genomic DNA Isolation Kit (Sangon Biotech, Shanghai, China) according to the manufacturer’s protocol. Purified DNA was subjected to whole genomic sequencing on the Illumina HiSeq 2000 system with the 150-bp paired-end approach and 150× coverage. Reads were trimmed using Trimmomatic22 (link) and were then assembled using the SOAP de novo program.23 (link) Annotation was carried out using Prokka.24 (link) The species identification was performed by average nucleotide identity (ANI) analysis with JSpeciesWS (

http://jspecies.ribohost.com/jspeciesws/#analyse

). Antimicrobial resistance genes were identified using ResFinder v3.1 of the Center for genomic epidemiology (

http://genomicepidemiology.org/

Yuan Y., Li Y., Wang G., Li C., Xiang L., She J., Yang Y., Zhong F, & Zhang L. (2019). Coproduction Of MCR-9 And NDM-1 By Colistin-Resistant Enterobacter hormaechei Isolated From Bloodstream Infection. Infection and Drug Resistance, 12, 2979-2985.

+ Open protocol

+ Expand

Comprehensive Genotyping of S. aureus

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA extraction was carried out using the Rapid Bacterial Genomic DNA Isolation Kit (Sangon Biotech, Shanghai, China) following the manufacturer’s protocol. MLST was conducted by amplifying internal fragments of seven housekeeping genes (arcC, aroE, glpF, gmk, pta, tpi, and yqiL) of S. aureus, as previously described.9 (link) The obtained PCR product sequences were then compared to the existing alleles in the MLST database (

http://saureus.mlst.net/

), which assigned a specific allelic number, known as a sequence type (ST), to each isolate. Amplification of the spa gene was also performed using previously described primers.10 (link),11 (link) The PCR products were sequenced by Tsingke Biological Technology Company (TsingKe, Beijing, China), and the spa types were determined using the Ridom SpaServer (

http://www.spaserver.ridom.de

). The identification of MRSA was initially carried out through cefoxitin screening, with confirmed cases being verified by the presence of the mecA gene using PCR (F: 5’-3’ GTGAAGATATACCAAGTGATT; R: 5’-3’ ATGCGCTATAGATTGAAAGGAT).12 (link) SCCmec typing of MRSA isolates was conducted using a battery of multiplex PCRs, as previously described.13 (link) MRSA isolates that displayed unanticipated fragments or lacked fragments in the multiplex PCR were categorized as non-typeable (NT).

Wang W., Zhong Q., Cheng K., Tan L, & Huang X. (2023). Molecular Characteristics, Antimicrobial Susceptibility, Biofilm-Forming Ability of Clinically Invasive Staphylococcus aureus Isolates. Infection and Drug Resistance, 16, 7671-7681.

+ Open protocol

+ Expand

Enumeration and Identification of Bifidobacterium

Check if the same lab product or an alternative is used in the 5 most similar protocols

All the stool samples were assessed for the presence of Bifidobacterium. One gram of each stool sample was blended with 9 mL sterile physiological saline. Serial dilution and plating were executed in an anaerobic workstation (AW400TG, Electrotek Scientific Ltd., West Yorkshire, UK). 100 μl of diluent was continuously plated on de Man-Rogosa-Sharpe (MRS) agar plus 0.05% (w/v) L-cysteine hydrochloride (mMRS), 100 mg/L mupirocin (Sangon Biotech Co., Ltd., Shanghai, China) and 50 U/mL nystatin (Sangon Biotech Co., Ltd., Shanghai, China). Agar plates were cultured in the anaerobic workstation flushed with 80% N₂, 10% CO₂, and 10% H₂ at 37°C for 72 h. For each sample, colonies on mMRS plates were counted. Colonies were selected at random and re-streaked onto mMRS agar for purity. The final pure culture was cultured in mMRS broth and preserved in 30% glycerol at −80°C. DNA was extracted from each strain using the Rapid Bacterial Genomic DNA Isolation Kit (Sangon Biotech Co., Ltd., Shanghai, China) and stored at −20°C. Each of the putative Bifidobacterium isolates was identified by a 16S rRNA sequence using the bacterial universal primers (27 F: 5ʹ-AGAGTTTGATCCTGGCTCAG-3ʹ and 1492 R: 5ʹ-ACGGCTACCTTGTTACGACTT-3ʹ) by BGI (Shenzhen, China). All the strains were compared with the NCBI BLAST database (http://www.ncbi.nlm.nih.gov/BLAST/) to assign a particular species.

Yang B., Ding M., Chen Y., Han F., Yang C., Zhao J., Malard P., Stanton C., Ross R.P., Zhang H, & Chen W. (2021). Development of gut microbiota and bifidobacterial communities of neonates in the first 6 weeks and their inheritance from mother. Gut Microbes, 13(1), 1908100.

+ Open protocol

+ Expand

Genome Editing and Sequencing of S. aureus

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomes of four edited S. aureus RN4220 strains were extracted using the Rapid Bacterial Genomic DNA Isolation Kit (Sangon Biotech, Shanghai, China). The isolated genomes were used as templates for PCR-amplification of ∼200 bp DNA fragments containing the edited sites. The barcode sequences were included on the 5′ terminus of the forward primers. Purified DNA products were sent out for sequencing using the Illumina Hiseq X Ten (2 × 150) platform at GENEWIZ (Suzhou, China). Fifty thousand reads per sample were analyzed. The experiments were performed in triplicate. The wild-type S. aureus RN4220 strain was performed following the same process as control.

Zhang Y., Zhang H., Wang Z., Wu Z., Wang Y., Tang N., Xu X., Zhao S., Chen W, & Ji Q. (2020). Programmable adenine deamination in bacteria using a Cas9–adenine-deaminase fusion †Electronic supplementary information (ESI) available. See DOI: 10.1039/c9sc03784e. Chemical Science, 11(6), 1657-1664.

+ Open protocol

+ Expand

Whole-Genome Sequencing of Edited S. aureus

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomes of the wild-type and two edited S. aureus RN4220 strains were extracted using the Rapid Bacterial Genomic DNA Isolation Kit (Sangon Biotech, Shanghai, China) and sent out for whole-genome sequencing by the BGISEQ PE150 platform at Beijing Genomics Institute. The paired-end fragment libraries were sequenced according to the Illumina HiSeq 4000 system's protocol. Raw reads of low quality from paired-end sequencing were discarded. The assembly scaffolds were aligned with reference sequence (GCA_000212435.2) for detection of single nucleotide polymorphism (SNP).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!