Anti cd62l apc

Manufactured by Thermo Fisher Scientific

Sourced in United States

The Anti-CD62L-APC is a flow cytometry antibody that binds to the CD62L (L-selectin) cell surface antigen. CD62L is expressed on various leukocyte subsets and plays a role in cell adhesion and trafficking. The Anti-CD62L-APC antibody is conjugated with the fluorescent dye Allophycocyanin (APC), allowing for the detection and analysis of CD62L-positive cells using flow cytometry.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

CD62L (58 citations) Anti-CD62L (24 citations) CD62L-APC (9 citations) Anti-CD62L-APC (MEL-14, (3 citations) Anti-mouse CD62L APC (3 citations) Anti-mouse CD62L conjugated to APC (2 citations) Anti-CD62L-APC eFluor780 (2 citations) APC-eFluor780-labeled anti-mouse CD62L (2 citations)

10 protocols using anti cd62l apc

Activated and Memory T Cell Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Ten days after the third immunization, splenocytes were collected from OVA antigen-immunized C57BL/6 mice. Frequencies of activated T cells and memory T cells in splenocytes were measured by flow cytometry. Cells were cultured in RPMI 1640 supplemented with 10% fetal bovine serum (4.0×10 6 cells/mL) and re-stimulated with peptide for 60 h. Cells stimulated with MHC I peptide (OVA 257-264 , 1 μg/mL) were stained with the following set of fluorochromeconjugated anti-mouse antibodies: Alexa Fluor 488-anti-CD8α, PE-anti-CD44, APC-anti-CD62L, and eFluor 450anti-CD69 (eBioscience). Cells stimulated with MHC II peptide (OVA 323-339 , 2 μg/mL) were stained with the following set of fluorochrome-conjugated anti-mouse antibodies: eFluor 450-anti-CD4, PE-anti-CD44, APC-anti-CD62L, and FITC-anti-CD69 (eBioscience). After washing, cell samples were examined by Beckman Coulter CyAn ™ ADP flow cytometer, and data were analyzed by Summit software (version 4.3).

Zhang W., Wang L., Yang T., Liu Y., Chen X., Liu Q., Jia J, & Ma G. (2015). Immunopotentiator-Loaded Polymeric Microparticles as Robust Adjuvant to Improve Vaccine Efficacy. Pharmaceutical research, 32(9).

+ Open protocol

+ Expand

Analyzing Tumor-Specific Immune Responses

Check if the same lab product or an alternative is used in the 5 most similar protocols

To systematically investigate the in vivo antitumour immune responses against mimic distant tumours, the tumours were harvested and treated with the tissue dissociation kit (Miltenyi Biotec, Germany) to produce a single-cell suspension according to the specified procedures. The harvested cells were further stained with several fluorochrome-conjugated antibodies: CD45-FITC (BD, Catalog: 561088), CD3-PerCP-Cy5.5 (BD, Catalog: 551163), CD4-BV510 (BD, Catalog: 563106), CD8-BV421 (BD, Catalog: 563898), NKp46-APC (Biolegend, Catalog: 137608), B220-PE-Cy7 (BD, Catalog: 552772) and Foxp3-PE (eBioscience, Catalog: 12–4771) and then analysed by FCM. For the analysis of the memory T cells, spleen cells of mice were harvested and stained with anti-CD3-FITC (Biolegend, Catalog: 100306), anti-CD4-PE-Cy7 (eBioscience, Catalog: 25–0041), anti-CD8-PerCP-Cy5.5 (eBioscience, Catalog: 45–0081), anti-CD44-PE (eBioscience, Catalog: 12–0441) and anti-CD62L-APC (eBioscience, Catalog: 17–0621) antibodies and then analysed by FCM. All antibodies were diluted ~100 times.

Yue W., Chen L., Yu L., Zhou B., Yin H., Ren W., Liu C., Guo L., Zhang Y., Sun L., Zhang K., Xu H, & Chen Y. (2019). Checkpoint blockade and nanosonosensitizer-augmented noninvasive sonodynamic therapy combination reduces tumour growth and metastases in mice. Nature Communications, 10, 2025.

+ Open protocol

+ Expand

Th17 Cell Differentiation and SNP Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Naive CD4⁺ T cells were purified from spleens of CB6F1 mice using anti‐CD4 microbeads (Miltenyi Biotech, Auburn, CA, USA) then stained with anti‐CD4‐PerCP, anti‐CD62L‐APC, and anti‐CD44‐PE antibodies (eBioscience‐ThermoFisher, Waltham, MA, USA). CD4⁺CD62L^highCD44^low T cells were sorted using a BD FACSAria cell sorter. Th17 cells were differentiated on plates coated with anti‐CD3 (2 µg ml⁻¹) and anti‐CD28 (2 µg ml⁻¹), in the presence of 2 ng ml⁻¹ rhTGF‐β1, 25 ng ml⁻¹ rmIL‐6 and, 20 ng ml⁻¹rmIL‐23. RNA was extracted after 72 h using RNeasy mini KIT (Qiagen, Hilden, Germany) and reverse transcribed with High‐Capacity cDNA Reverse Transcription Kit (Applied Biosystems‐ThermoFisher, Waltham, MA, USA). A sequence fragment containing SNP rs48924577 was amplified using primers 5′‐CGCCCTTCCATGCCTTAGC‐3′ and 5′‐ CTCCAGAGCTGCACTTCTCA‐3′. Purified PCR products were sequenced by MiSeq (Illumina, San Diego, CA, USA).

Lian S.L., Mihi B., Koyanagi M., Nakayama T, & Bix M. (2017). A SNP uncoupling Mina expression from the TGFβ signaling pathway. Immunity, Inflammation and Disease, 6(1), 58-71.

+ Open protocol

+ Expand

Evaluating Memory T Cell Responses in Tumor-Bearing Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

After the elimination of primary CT26 tumors by surgery or bacteria plus laser for 40 days, the second batch of CT26 cells (1 × 10⁶) was subcutaneously injected into those mice again. The tumor sizes were then closely recorded. For analyzing the percent of memory T cells, spleens harvested from mice in different groups were stained with anti–CD3-FITC (BioLegend, clone: 145-2C11, catalog no. 100306, lot: B241616), anti–CD8-PerCP-Cy5.5 (eBioscience, clone: 53-6.7, catalog no. E08300-1633), anti–CD62L-APC (eBioscience, clone: MEL-14, lot: 4300018), and anti–CD44-PE (BioLegend, clone: IM7, catalog no. 103007, lot: B185651) antibodies according to the manufacturers’ protocols. Flow cytometry was used for analyzing the percentage of T_CM (CD3⁺CD8⁺CD62L⁺CD44⁺) and T_EM (CD3⁺CD8⁺CD62L⁻CD44⁺).

Yi X., Zhou H., Chao Y., Xiong S., Zhong J., Chai Z., Yang K, & Liu Z. (2020). Bacteria-triggered tumor-specific thrombosis to enable potent photothermal immunotherapy of cancer. Science Advances, 6(33), eaba3546.

+ Open protocol

+ Expand

Isolation and Analysis of CD16bright Neutrophils

Check if the same lab product or an alternative is used in the 5 most similar protocols

Since the CD16^brightCD62L^dim neutrophil subtype is present at extremely low levels in patients, to successfully identify this neutrophil subtype, we collected 4 ml fresh anticoagulated blood samples from enrolled patients, applied the Human Peripheral Blood Neutrophil Isolation Kit (Stemcell, Canada), and isolated approximately 5×10⁶ neutrophils from each specimen. Neutrophils were stained with flow antibodies, including anti-CD16-FITC (eBioscience, USA) and anti-CD62L-APC (eBioscience, USA), at room temperature and protected from light for 30 min. Finally, neutrophils were analyzed by multicolor flow cytometry (ACEABIO, USA), and the results were processed by FlowJo v10.0.7 software (Tree Star, Ashland, OR, USA).

Zhang J., Gao C., Zhu Z., Li D., Qu L., Xue Q., Wang G., Ji T, & Wang F. (2024). New findings on CD16brightCD62Ldim neutrophil subtypes in sepsis-associated ARDS: an observational clinical study. Frontiers in Immunology, 15, 1331050.

+ Open protocol

+ Expand

Detecting Virus-Specific T Cells in Lungs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lungs were digested with collagenase-A (Roche Diagnostics, Mannheim, Germany) and DNAse-I (Sigma-Aldrich), filtered through a 70-µm filter (BD Biosciences), red blood cells lysed, washed, and resuspended in FACS buffer. Live cells were counted using 0.4% Trypan-Blue (Sigma-Aldrich) dead-cell exclusion. Cells were blocked using 5% normal mouse serum and 5% normal rat serum (Jackson ImmunoResearch Laboratories Inc, West Grove, PA), and 1% Fc-receptor-block (anti-mouse CD16/32; eBioscience, San Diego, CA), and then stained with anti-mouse antibodies for anti-CD3-FITC, anti-CD4-PE-Cy7, anti-CD62L–APC, anti-CD8-APC-Cy7, anti-PD-1-PE (clone DX5), and anti-CD44-PerCP-Cy5.5 (eBioscience). Viral specific SeV⁺ T cells were detected using tetrameric MHC-peptide reagents for SeV nucleoprotein (NP_324–332) complexed with K^b conjugated to PE provided by the National Institute of Allergy and Infectious Disease Tetramer Core Facility. Fluorescence was measured (FACSCantoII flow cytometer) and analyzed using FlowJo software (Tree Star Inc, Ashland, OR).

Gowdy K.M., Martinu T., Nugent J.L., Manzo N.D., Zhang H., Kelly F.L., Holtzman M.J, & Palmer S.M. (2014). Impaired CD8+ T cell immunity after allogeneic bone marrow transplantation leads to persistent and severe respiratory viral infection. Transplant immunology, 32(1), 51-60.

+ Open protocol

+ Expand

Activation and Migration of T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

TCL, loaded or not with NBR, were stimulated with MOG_35–55 (10 μg mL⁻¹) and analyzed after 12 and 24 hours in order to evaluate the expression of CD25 (activation) and CD62L (a key regulator of migration, early-modulated during cell activation). Cells were stained (20 minutes RT in the dark) with the following fluorescent anti-mouse monoclonal antibodies (all from eBioscience): anti-CD25 PE (1 : 100 diluted), anti-CD62L APC (1 : 600 diluted), anti-CD3ε FITC (1 : 100 diluted). Then the cells were analysed with a CyFlow Space cytometer (Sysmex-Partec, Germany).

D'Elios M.M., Aldinucci A., Amoriello R., Benagiano M., Bonechi E., Maggi P., Flori A., Ravagli C., Saer D., Cappiello L., Conti L., Valtancoli B., Bencini A., Menichetti L., Baldi G, & Ballerini C. (2018). Myelin-specific T cells carry and release magnetite PGLA–PEG COOH nanoparticles in the mouse central nervous system. RSC Advances, 8(2), 904-913.

+ Open protocol

+ Expand

Multiparameter Flow Cytometry Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Single cell suspensions of splenocytes and lymph node cells were stained with the following antibodies (all from Biolegend unless otherwise stated): anti-CD4-BV605/PB/PE/PE-Cy7, anti-CD25-APC/PE (Miltenyi Biotec)/PerCP-Cy5.5, anti-CD44-APC-Cy7, anti-CD62L-APC, anti-GITR-PE-Cy7, anti- Foxp3-PE/eFluor450 (eBioscience) and Ki-67-PerCP-eFluor710 (eBioscience), anti-caspase-3-PE (BD Pharmingen), anti-BrdU-PE (BD Pharmingen). Intranuclear staining for Foxp3 and Ki-67 was performed using Foxp3 Fixation/Permeabilization buffers (eBioscience), and caspase-3 staining was performed using Cytofix/Cytoperm kit as per manufacturer's instructions (BD Pharmingen). Prior to surface staining cells were stained with fixable viability dye eFluor780 (eBioscience) if indicated. The samples were acquired on the LSR II flow cytometer (BD) and analyzed using FlowJo software (Tree Star).

Nowakowska D.J, & Kissler S. (2016). PTPN22 modifies regulatory T cell homeostasis via GITR upregulation. Journal of immunology (Baltimore, Md. : 1950), 196(5), 2145-2152.

+ Open protocol

+ Expand

Neutrophil Activation Assay Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tables 1 and 2 list materials and formulations used.
The following flow cytometry antibodies and their isotype controls were purchased from eBioscience (Thermo Fisher, Carlsbad, CA): anti-CD16 PE-Cy7 (eBioCB16, mouse IgG1, kappa); anti-CD62L APC (DREG56, mouse IgG1, kappa); anti-CD45 APC-eFluor780 (HI30, mouse IgG1). Anti-CD11b Alexa Fluor 647 (EPR1344, rabbit), Anti-CD63 (MEM-259, mouse IgG1), human and rat preadsorbed rabbit antimouse IgG Alexa Fluor 597, their isotype controls and normal goat serum for immunofluorescence microscopy were purchased from Abcam (Cambridge, MA). N-formyl-Met-Leu-Phe [fMLP], phorbol 12-myristate 13-acetate [PMA], dextran (MW 450–650 kDa) and human serum albumin (HSA) were purchased from Sigma-Aldrich (St. Louis, MO – now Merck KGaA, Darmstadt Germany). Ionomycin, RPMI 1640 cell culture medium and the LIVE/DEAD Aqua fixable dead cell stain were purchased from Life Technologies (Thermo Fisher, Carlsbad, CA). The neutrophil gelatinase-associated lipocalin (NGAL) DuoSet for ELISA, HRP and ELISA visualization reagents were purchased from R&D Systems (Minneapolis, MN). Lymphoprep was purchased from StemCell Technologies (Vancouver, British Columbia, Canada). Human AB serum was purchased from Fisher Scientific (Thermo Fisher, Carlsbad, CA).

Bisso P.W., Gaglione S., Guimarães P.P., Mitchell M.J, & Langer R. (2018). Nanomaterial Interactions with Human Neutrophils. ACS biomaterials science & engineering, 4(12), 4255-4265.

+ Open protocol

+ Expand

Multiparametric Flow Cytometry Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Whole spleens and thymuses were disaggregated into single cell suspensions and stained for surface receptors for 30 min, followed by washing twice with buffer and flow cytometric analysis. Whole intestines were flushed twice with Hank's buffered saline solution (HBSS) and washed twice in HBSS to remove debris. Intestines were then digested with 1 mg/ml collagenase IV and 40 μg/ml DNAse I shaking for 15 min 37°C to prepare single cell suspensions, followed by washing in HBSS. Data was collected using a LSRFortessa X20 (BD Biosciences, San Jose, CA). Anti-γδTCR FITC, anti-CD44 PerCP-Cy5.5, anti-CD62L APC, anti-CD19 Alexa 700, anti-TCRβ APC-Cy7, anti-CD4 PE-610, anti-CD69 eFluor450, anti-F4/80 APC, anti-MHCII Alexa 700, and anti-CD11b PE-Cy7 were from Thermo Fisher Scientific (Carlsbad, CA). Anti-CD8 BV 605, anti-CD25 PE, and anti-Ly6G BV 421 were from Biolegend (San Diego, CA). Anti-NK1.1 FITC and anti-CD11c PE were from BD Biosciences (San Jose, CA).

Veny M., Grases D., Kucharova K., Lin W.W., Nguyen J., Huang S., Ware C.F., Ranscht B, & Šedý J.R. (2020). Contactin-1 Is Required for Peripheral Innervation and Immune Homeostasis Within the Intestinal Mucosa. Frontiers in Immunology, 11, 1268.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!