Log In Sign up
The largest database of trusted experimental protocols

Hrp conjugated goat anti mouse or rabbit igg

Manufactured by Thermo Fisher Scientific
Visit Supplier

HRP-conjugated goat-anti mouse or rabbit IgG is a secondary antibody conjugated with horseradish peroxidase (HRP). It is used for the detection of mouse or rabbit primary antibodies in various immunoassays and immunohistochemical applications.

Automatically generated - may contain errors

Lab products found in correlation

Control mouse igg, by Santa Cruz Biotechnology (3 mentions) Control rabbit igg, by Merck Group (3 mentions) Mouse anti flag, by Fortrea (2 mentions) Mouse anti β actin, by Fortrea (2 mentions) Mouse anti ha, by Fortrea (2 mentions) Mouse anti gfp, by Sungene Biotech (2 mentions) Anti ubiquitin, by Merck Group (2 mentions) Tyramide signal amplification kit, by Thermo Fisher Scientific (2 mentions) Cpg b, by InvivoGen (1 mentions) Mms 101r, by Fortrea (1 mentions) Lipopolysaccharides (lps), by Merck Group (1 mentions) Anti ubiquitin, by Abcam (1 mentions) Anti iκbα, by Abcam (1 mentions) Anti tbk1, by Abcam (1 mentions) Anti p iκbα, by Abcam (1 mentions) Anti irf3, by Abcam (1 mentions) Anti pirf3, by Abcam (1 mentions) Anti usp13, by Abcam (1 mentions) Anti sting, by Abcam (1 mentions) 1680 scanner, by Epson (1 mentions)

Close spelling variants of this product

Goat anti-rabbit HRP (85 citations) Goat anti-mouse HRP (78 citations) HRP-conjugated goat anti-rabbit (21 citations) HRP-conjugated goat anti-mouse (18 citations) HRP-anti-mouse (6 citations) IgG Rabbit (4 citations) Mouse anti-IgG (2 citations)

7 protocols using hrp conjugated goat anti mouse or rabbit igg

1

Immunoblotting for Protein Analysis

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Mouse control IgG (Santa Cruz Biotechnology, sc-2025) and rabbit control IgG (Millipore, 12–370), HRP-conjugated goat-anti mouse or rabbit IgG (Thermo Scientific, PA1-86717 and SA1-9510) (1:3000), mouse anti-GFP (Sungene Biotech, KM8009) (1:2000), mouse anti-FLAG (KM8002) (1:2000), mouse anti-β-Actin (KM9001) (1:2000), mouse anti-HA (COVANCE, MMS-101R) (1:2000), anti-pIκBα (9246 L)(1:1000), anti-Ubiquitin (sc-8017) (1:500), anti-Ubiquitin, K48 specific (Merck, 05-1307), anti-IRF3 (sc-9082) (1:1000), anti-IκBα (sc-371) (1:1000), anti-p-IRF3 (4947 S) (1:1000), anti-TBK1 (GR96328-11) (1:2000) and anti-cGAS (sc-515777) (1:1000)were purchased from the indicated manufactures. LPS (Sigma, L2630) and CpG-B (Invivogen, tlr-1826) were purchased from the indicated manufactures. Poly(I:C), ISD45, DNA90, and HSV120 were previously described.35 (link) ISD45: 5′-TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA-3′; DNA90: 5′-TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACATACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA-3′; HSV120: 5′-AGACGGTATATTTTTGCGTTATCACTGTCCCGGATTGGACACGGTCTTGTGGGATAGGCATGCCCAGAAGGCATATTGGGTTAACCCCTTTTTATTTGTGGCGGGTTTTTTGGAGGACTT-3′.
Zhang Q., Tang Z., An R., Ye L, & Zhong B. (2020). USP29 maintains the stability of cGAS and promotes cellular antiviral responses and autoimmunity. Cell Research, 30(10), 914-927.
+ Open protocol
+ Expand
2

Western Blotting Antibody Reagents

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mouse control IgG (Santa Cruz Biotechnology, sc-2025) and rabbit control IgG (Millipore, 12–370), HRP-conjugated goat-anti mouse or rabbit IgG (Thermo Scientific, PA1-86717 and SA1-9510)(1:3,000), mouse anti-GFP (Sungene Biotech, KM8009)(1:1,000), mouse anti-FLAG (KM8002)(1:2,000), mouse anti-β-Actin (KM9001)(1:1,000), mouse anti-HA (COVANCE, MMS-101 R)(1:2,000), anti-pIκBα (9246L)(1:1,000), anti-Ubiquitin (sc-8017)(1:1,000), anti-IRF3 (sc-9082)(1:500), anti-IκBα (sc-371)(1:500), anti-p-IRF3 (4947 S)(1:1,000), anti-USP13 (abcam, GR56969-12)(1:500), anti-TBK1 (GR96328-11)(1:1,000) and anti-STING (13647 S)(1:1,000) were purchased from the indicated manufactures. Poly(I:C), ISD45, DNA90 and HSV120 were previously described36 (link)37 (link)38 (link)39 (link). ISD45: 5′-TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA-3′; DNA90: 5′-TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACATACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA-3′; HSV120: 5′-AGACGGTATATTTTTGCGTTATCACTGTCCCGGATTGGACACGGTCTTGTGGGATAGGCATGCCCAGAAGGCATATTGGGTTAACCCCTTTTTATTTGTGGCGGGTTTTTTGGAGGACTT-3′.
Sun H., Zhang Q., Jing Y.Y., Zhang M., Wang H.Y., Cai Z., Liuyu T., Zhang Z.D., Xiong T.C., Wu Y., Zhu Q.Y., Yao J., Shu H.B., Lin D, & Zhong B. (2017). USP13 negatively regulates antiviral responses by deubiquitinating STING. Nature Communications, 8, 15534.
+ Open protocol
+ Expand
3

Standardized Western Blot Protocols

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
Western blot was performed as previously described (Shen et al., 2008 (link)), with primary antibodies: anti-Wls (rabbit, 1:500, home-made) (Yu et al., 2010 (link)), Synapsin 1 (rabbit, 1:1000, CST, 5297), anti-GAPDH (mouse, 1:5000, Proteintech, Cat# 60004), and anti-α-tubulin (mouse, 1:3000, Santa Cruz, Cat# 23948). After washing, membranes were incubated with secondary antibodies HRP-conjugated goat anti-mouse or rabbit IgG (1:5000; Thermo Fisher Scientific, Cat# 31430 and 31460). Immunoreactive bands were visualized using enhanced chemiluminescence (Thermo Fisher Scientific). Autoradiographic films were scanned with an Epson 1680 scanner, and captured images were analyzed with Image J.
Shen C., Li L., Zhao K., Bai L., Wang A., Shu X., Xiao Y., Zhang J., Zhang K., Hui T., Chen W., Zhang B., Hsu W., Xiong W.C, & Mei L. (2018). Motoneuron Wnts regulate neuromuscular junction development. eLife, 7, e34625.
+ Open protocol
+ Expand
4

Apoptosis Signaling Pathway Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Caspase-8 inhibitor (MCE); caspase-9 inhibitor (MCE); general caspase inhibitor (MCE); STS (Selleck); anti-cytochrome c (Abcam); anti-glutamate dehydrogenase (GDH; CST); HRP-conjugated goat-anti mouse or rabbit IgG (Thermo Scientific); anti-β-Actin (Sigma); anti-caspase-8 (TransGen Biotech ProteinFind); anti-cleaved-caspase-8 (CST); anti-caspase-9 (TransGen Biotech ProteinFind); anti-cleaved-caspase-9 (CST); anti-FLAG (Sigma); anti-ASK (CST); anti-p-ASK (CST); anti-FKHRL1 (CST); anti-p-FKHRL1 (CST); anti-PKB/Akt (CST); anti-p-PKB/Akt (CST); anti-GFP (Sigma), ECL(4A Biotech).
Ren Y., Wang A., Fang Y., Shu T., Wu D., Wang C., Huang M., Min J., Jin L., Zhou W., Qiu Y, & Zhou X. (2021). SARS-CoV-2 Membrane Glycoprotein M Triggers Apoptosis With the Assistance of Nucleocapsid Protein N in Cells. Frontiers in Cellular and Infection Microbiology, 11, 706252.
+ Open protocol
+ Expand
5

Antibodies and Nucleic Acid Probes for Immunoblotting

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Mouse control IgG (Santa Cruz Biotechnology, sc-2025) and rabbit control IgG (Millipore, 12–370), HRP-conjugated goat-anti mouse or rabbit IgG (Thermo Scientific, PA1-86717 and SA1-9510) (1:3000), HRP-conjugated mouse anti-FLAG (Sigma, A8592)(1:1000), mouse anti-FLAG (Sungene, KM8002)(1:2000), anti-GFP (Sungene, KM8009)(1:2000) anti-β-Actin (KM9001)(1:2000), anti-Tubulin (KM9003), anti-GAPDH(KM9002), anti-HA (COVANCE, MMS-101R)(1:2000), anti-Ubiquitin (sc-8017)(1:500), anti-Ubiquitin K63-specific linkage (Millipore 05–1308)(1:500), rabbit anti-TBK1(Abcam, 96328–11), anti-p-TBK1(Abcam, 109272), anti-IRF3 (sc-9082)(1:1000), anti-p-IRF3 (Cell Singling Technologies, 4947S)(1:1000), anti-IκBα (sc-371)(1:1000), anti-p-IκBα (Cell Singling Technologies, 9246L)(1:1000), anti-USP49 (proteintech,18066-1-AP), anti-mouse MITA and anti-human MITA (Cell Singling Technologies,13647) (proteintech, 19851-1-AP) were purchased from the indicated manufactures. ISD45, DNA90, and HSV120 were previously described [44 (link), 45 (link), 72 (link), 73 (link)]. ISD45: 5’-TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA-3’; DNA90: 5’-TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACATACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA-3’; HSV120: 5’-AGACGGTATATTTTTGCGTTATCACTGTCCCGGATTGGACACGGTCTTGTGGGATAGGCATGCCCAGAAGGCATATTGGGTTAACCCCTTTTTATTTGTGGCGGGTTTTTTGGAGGACTT-3’.
Ye L., Zhang Q., Liuyu T., Xu Z., Zhang M.X., Luo M.H., Zeng W.B., Zhu Q., Lin D, & Zhong B. (2019). USP49 negatively regulates cellular antiviral responses via deconjugating K63-linked ubiquitination of MITA. PLoS Pathogens, 15(4), e1007680.
+ Open protocol
+ Expand
6

Quantitative Analysis of Drug Metabolizing Enzymes in THLE-2 Cells

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
TeamChips were rinsed twice in PBS for 10 min each, followed by fixation with 3.7% formaldehyde in PBS for 20 min at room temperature and permeabilized with 0.1% Triton X-100 in PBS for 10 min45 (link). The chips were rinsed twice in PBS, incubated overnight in a blocking solution (SuperBlock, Pierce), and then rinsed three times in PBS-T for 5 min each. The primary antibodies (anti-CYP2C9, anti-CYP3A4, or anti-UGT1A4 at 1:250 dilution in PBS-T containing 1% (w/v) bovine serum albumin (BSA)) were then added to the TeamChips, and the chips were incubated overnight at 4°C. The chips were washed three times in PBS-T for 15 min each, and the secondary antibodies (HRP-conjugated goat-anti mouse or rabbit IgG, Invitrogen) at 1:500 dilution in PBS-T containing 1% (w/v) BSA were incubated with the TeamChip for 3 h at room temperature. A tyramide signal amplification kit (Invitrogen) was used according to manufacturer’s instructions to detect the human drug metabolizing enzymes expressed in THLE-2 cells through fluorescence analysis. The scanned images were obtained from the GenePix® scanner and analyzed by GenePix® Pro 6.0. The fluorescent signal from actin was used as an internal control.
Kwon S.J., Lee D.W., Shah D.A., Ku B., Jeon S.Y., Solanki K., Ryan J.D., Clark D.S., Dordick J.S, & Lee M.Y. (2014). High-Throughput and Combinatorial Gene Expression on a Chip for Metabolism-Induced Toxicology Screening. Nature communications, 5, 3739.
+ Open protocol
+ Expand
7

Quantitative Analysis of Drug Metabolizing Enzymes in THLE-2 Cells

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
TeamChips were rinsed twice in PBS for 10 min each, followed by fixation with 3.7% formaldehyde in PBS for 20 min at room temperature and permeabilized with 0.1% Triton X-100 in PBS for 10 min45 (link). The chips were rinsed twice in PBS, incubated overnight in a blocking solution (SuperBlock, Pierce), and then rinsed three times in PBS-T for 5 min each. The primary antibodies (anti-CYP2C9, anti-CYP3A4, or anti-UGT1A4 at 1:250 dilution in PBS-T containing 1% (w/v) bovine serum albumin (BSA)) were then added to the TeamChips, and the chips were incubated overnight at 4°C. The chips were washed three times in PBS-T for 15 min each, and the secondary antibodies (HRP-conjugated goat-anti mouse or rabbit IgG, Invitrogen) at 1:500 dilution in PBS-T containing 1% (w/v) BSA were incubated with the TeamChip for 3 h at room temperature. A tyramide signal amplification kit (Invitrogen) was used according to manufacturer’s instructions to detect the human drug metabolizing enzymes expressed in THLE-2 cells through fluorescence analysis. The scanned images were obtained from the GenePix® scanner and analyzed by GenePix® Pro 6.0. The fluorescent signal from actin was used as an internal control.
Kwon S.J., Lee D.W., Shah D.A., Ku B., Jeon S.Y., Solanki K., Ryan J.D., Clark D.S., Dordick J.S, & Lee M.Y. (2014). High-Throughput and Combinatorial Gene Expression on a Chip for Metabolism-Induced Toxicology Screening. Nature communications, 5, 3739.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!