One µl of Hot Fusion reaction was mixed with 20 µl of ElectroMax DH10B cells (Invitrogen) in a 1.5 ml centrifuge tube. Cells were transferred to a 0.1 cm electrocuvette (BioRad), and electroporated at 1.8 kv voltage setting. Electroporated cells were transferred to a 1.5 ml centrifuge tube, and mixed with 300 µl of SOC medium (Invitrogen) and incubated for 1 hour at 37°C. Between 10 µl and 150 µl of cells were plated onto LB plates containing appropriate antibiotics, and X-gal when needed. Plates were then incubated overnight at 37°C.
Soc medium
Manufactured by Thermo Fisher Scientific
Sourced in United States
SOC medium is a complex microbiological growth medium used to support the growth of a variety of bacterial species. It is commonly used in the preparation and transformation of competent bacterial cells, particularly Escherichia coli, for molecular biology applications.
Automatically generated - may contain errors
Lab products found in correlation
Electromax dh10b cells, by Thermo Fisher Scientific (1 mentions)
Bl21 star, by Thermo Fisher Scientific (1 mentions)
Maxiprep plasmid purification kit, by Qiagen (1 mentions)
One shot top10, by Thermo Fisher Scientific (1 mentions)
Synergy htx plate reader, by Agilent Technologies (1 mentions)
Wizard plus sv miniprep kit, by Promega (1 mentions)
Bluo gal, by Thermo Fisher Scientific (1 mentions)
Isopropyl β d 1 thiogalactopyranoside (iptg), by Thermo Fisher Scientific (1 mentions)
Dpni, by New England Biolabs (1 mentions)
Carbenicillin, by Merck Group (1 mentions)
Polynucleotide kinase, by New England Biolabs (1 mentions)
0.2 cm cuvette, by Bio-Rad (1 mentions)
Ez tn5, by Illumina (1 mentions)
Gene pulser xcell electroporation system, by Bio-Rad (1 mentions)
Champion pet 200 topo expression kit, by Thermo Fisher Scientific (1 mentions)
One shot top10 chemically competent e coli cells, by Thermo Fisher Scientific (1 mentions)
Safeview classic, by Applied Biological Materials (1 mentions)
Miniprep kit, by Qiagen (1 mentions)
E coli top10 cells, by Thermo Fisher Scientific (1 mentions)
Gene pulser xcell system, by Bio-Rad (1 mentions)
19 protocols using soc medium
1
Bacterial Transformation by Electroporation
2
Generation of Recombinant β-CA Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The construct of the β-CA sequence from the freeze-dried plasmid supplied by GeneArt was prepared according to the instructions of the manufacturer. The BL21 Star™ (DE3) cells were stored at −80 °C cells (Invitrogen, Carlsbad, CA, USA) and thawed by keeping them on ice. After thawing the competent cells, 25 µl of the cell suspension and 1 µl of the reconstituted plasmid, were transferred into a 1.5 ml centrifuge tube. The suspension was incubated on ice for 30 min. Heat shock was performed by keeping the tube in 42 °C water for 30 s, and transferred immediately on ice for 2 min. 125 µl of SOC Medium (Invitrogen, Carlsbad, CA, USA) was added to the microcentrifuge tube containing the transformed cells, and the tube was incubated at 37 °C for 1 h with shaking (200 rpm). The agar plates containing gentamycin were stored at 37 °C before the transformation. 20 µl or 50 µl of cell suspension described above were spread onto each plate, and the plates were incubated overnight at 37 °C . A volume of 5 ml preculture was prepared by inoculating single colonies from growth plates onto an LB medium with gentamycin (ratio 1:1000), being then incubated overnight at 37 °C with constant shaking of 200 rpm.
3
Plasmid Transformation and Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DH5α Escherichia coli-competent cell was transformed separately with two CMV plasmids containing the PGK1 (luciferase) gene and the other, the TRβ gene (kindly given by Paul Webb, Diabetes Center—University of California San Francisco), in the concentrations of 1 µg/µL each. Bacteria and plasmids were incubated for 30 min on ice, subject to thermal shock by 1 min at 42 °C, followed by 2 min on ice. Subsequently 250 µL of S.O.C medium (Invitrogen) were added and the mixture incubated for 1.5 h at 37 °C under agitation of 180 rpms. After centrifugation at 2000 rpm, the bacterial pellet was re-suspended in 50 µL of S.O.C and plated in Petri dishes with LB solid medium containing ampicillin (100 µg/mL) for 12 h. A colony was collected and grown in 500 mL LB, containing ampicillin (100 µg/mL) for 12 h. The liquid culture was centrifuged at 2000 rpm, and the plasmids were purified according to the Qiagen Protocol of Maxi prep Plasmid Purification Kit.
4
Plasmid Transformation and Adaptation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmids expressing tolerance gene candidates were transformed into chemically competent E. coli DH1 containing the plasmids for isopentenol production, pJBEI-6830 and pJBEI-6833 (6 (link)), resulting in a three-plasmid-containing strain. The transformants were recovered in SOC medium (Invitrogen) for 1 h at 37°C and plated on LB agar supplemented with the appropriate antibiotics.
The strains were adapted to defined M9 minimal medium by subcultivating single colonies in minimal medium. Single colonies were inoculated into 5 ml LB medium supplemented with the appropriate antibiotics and were grown overnight at 37°C with shaking. The overnight cultures were diluted 100-fold in 5 ml minimal medium (M9 for the single-plasmid strains and MM9 for the production strains) supplemented with the appropriate antibiotics and grown for 24 h at 37°C with shaking. Subcultivation was repeated twice more to fully adapt the cells. The adapted cells were centrifuged (3,000 × g, 2 min), resuspended in the respective minimal medium with 10% glycerol added, and stored at −80°C in 50-µl aliquots.
The strains were adapted to defined M9 minimal medium by subcultivating single colonies in minimal medium. Single colonies were inoculated into 5 ml LB medium supplemented with the appropriate antibiotics and were grown overnight at 37°C with shaking. The overnight cultures were diluted 100-fold in 5 ml minimal medium (M9 for the single-plasmid strains and MM9 for the production strains) supplemented with the appropriate antibiotics and grown for 24 h at 37°C with shaking. Subcultivation was repeated twice more to fully adapt the cells. The adapted cells were centrifuged (3,000 × g, 2 min), resuspended in the respective minimal medium with 10% glycerol added, and stored at −80°C in 50-µl aliquots.
5
Plasmid Transformation Using Chemically Competent Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmid products of cycled ligation reactions were directly transformed into chemically competent bacteria (One Shot TOP10, Invitrogen) according to the manufacturer’s protocol. Briefly, 2 µl of the cycled ligation reaction mixture was added to 50 µl of competent cells on ice. After 30 min on ice, the cells were placed in a 42°C water bath for 30 sec and then on ice for 2 min. 250 µl of pre-warmed (37°C) SOC medium (Invitrogen) was added and the cells were incubated for 1 hr at 37°C and 225 RPM. 250 µl were spread onto a pre-warmed LB+Ampicillin 10 cm plate. Plates were incubated at 37°C overnight.
6
Heterologous tRNA Gene Expression in E. coli
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chemically competent E. coli MG1655 cells were transformed with the pCDF plasmid encoding a tRNAProX gene with or without a proSx gene (K. setae or S. turgidiscabies). After transformation, cells were recovered in S.O.C. medium (Invitrogen) at 37 °C for 1 h with constant shaking. Following recovery, transformants were plated on LB-agar with respective antibiotics and grown overnight at 37 °C. Single colonies were used to inoculate 150 μl of fresh LB medium with the corresponding antibiotics in black-sided 96-well plates with clear flat bottoms (Corning). Cell growth (absorbance, A) was measured at 600 nm (A600) for 20 h of incubation at 37 °C and constant shaking using a BioTek synergy HTX plate reader.
7
Quantifying Mutation Rates in Breast Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Control (0 MM) and mismatch (U/G MM)-containing plasmids (1.5 μg per well in 6-well plate) were transfected into breast cancer cells, extracted 48 hr later using the Wizard Plus SV Miniprep kit (Promega, A1460), and treated with DpnI (NEB, R0176) for 15 min at 37°C. Plasmids (5 ng) were electroporated into 20 μL MBM7070 competent cells. After transformation, the cells were recovered in S.O.C. medium (Invitrogen, 15544–034) for 1 hr at 37°C and plated on LB agar plates containing 100 μg/mL carbenicillin (Sigma-Aldrich, C1389), 1 mM IPTG (Invitrogen, 15529–019), and 0.03% (w/v) Bluo-Gal (Invitrogen, 15519–028). After incubation at 37°C overnight, the plates were stored at 4°C in the dark to allow color development. The percentage of white to total colonies (2,000–3,000) per sample was calculated as ‘mutation rate’. For mutation fate and trinucleotide context analysis shown in Figure 1D,E , we sequenced the reporter region (Figure 1A ) of the pSP189-SnA shuttle vector in all white colonies (ACGT, Inc) using primer R250 (TTTTTGTGATGCTCGTCAGG ) (Chen et al., 2014 (link)). Mutations were tabulated from the alignments between these sequences and the reference sequence of the starting reporter region.
8
Constructing Transposon Library of H10407
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A derivative of the transposon EZ-Tn5 (Epicentre) was phosphorylated with polynucleotide kinase (New England BioLabs) and incubated with EZ-Tn5 transposases (Epicentre) at 37 °C for 1 h to prepare the transposome that was stored at −20 °C until use. An overnight culture of H10407 was diluted 1:100 in LB broth and the bacteria were allowed to grow to an OD600 of 0.3–0.4. The bacterial cells were then harvested, washed three times in 0.5 volume of 10 % chilled glycerol and re-suspended in 1:1000 of the volume of the initial culture. Then, 40 µl of freshly prepared H10407 electrocompetent cells was mixed with 0.3–0.5 µl of transposomes and electrotransformed in a 0.2 cm cuvette (Bio-Rad Laboratories) using bacteria pre-setting parameters (2.5 kV, 25 µF and 200 Ω) in the Gene Pulser Xcell Electroporation System (Bio-Rad Laboratories). Cells were immediately re-suspended in 1 ml of SOC medium (Invitrogen) and incubated at 37 °C for 2 h before being spread on LB agar supplemented with kanamycin (20 µg ml−1). Individual colonies from 20 transformation batches were counted, scraped from plates using LB, and pooled to construct an initial transposon library consisting of ~1.1 million mutants of H10407. The library was aliquoted and kept in 25–30 % glycerol stock at −80 °C.
9
Cloning and Sequencing STARD10 from Radial Nerve
10
Plasmid Transfer in Enterobacteriaceae
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmids were prepared from overnight cultures of E. coli isolates E033, E066, E174, and E305 and K. pneumoniae isolates E187, E188, E196, E208, and E328, using a plasmid miniprep kit (Qiagen). Electrocompetent TOP10 E. coli cells (Invitrogen, Waltham, MA) were electroporated with the extracted plasmids using a Gene Pulser Xcell system (Bio-Rad, Hercules, CA). After incubation in S.O.C. medium (Invitrogen) for 2 h (6 h for isolate E305), transformants were selected on Luria-Bertani (LB) agar supplemented with 0.125 μg/ml meropenem (2 μg/ml cefotaxime for isolate E305).
Bacterial conjugation assays were performed using the transformants as donors and the sodium azide-resistantE. coli strain TUM3456 (47 (link)) as a recipient. After mixing overnight cultures of donors and recipients at a 1:10 volumetric ratio, the mixture (10 μl) was incubated on LB agar for 24 h at 37°C. Transconjugants were selected on LB agar containing cefotaxime (2 μg/ml) and sodium azide (150 μg/ml). The conjugation frequency was calculated from the CFU as the number of transconjugants divided by the number of donors plus transconjugants.
Bacterial conjugation assays were performed using the transformants as donors and the sodium azide-resistant
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!