Log In Sign up
The largest database of trusted experimental protocols

Lenti x 293t cells

Manufactured by Addgene
Visit Supplier

Lenti-X 293T cells are a human embryonic kidney cell line that is widely used for lentiviral vector production. These cells are known for their ability to efficiently produce high-titer lentiviral particles when transfected with the necessary plasmids.

Automatically generated - may contain errors

Lab products found in correlation

Lenti x 293t cells, by Takara Bio (4 mentions) Pmd2 g, by Addgene (3 mentions) Lenti x qrt pcr titration kit, by Takara Bio (2 mentions) Polyethylenimine max mw 40 000 da, by Polysciences (2 mentions) Lenti x concentrator, by Takara Bio (2 mentions) Opti mem, by Thermo Fisher Scientific (2 mentions) Dulbecco modified eagle medium (dmem), by Merck Group (2 mentions) Fetal bovine serum (fbs), by Merck Group (2 mentions) Pspax2, by Addgene (2 mentions) Peg it virus precipitation solution, by System Biosciences (2 mentions) Pcmvδr8, by Addgene (1 mentions) Pcmv vsv g, by Addgene (1 mentions) Profection mammalian transfection system, by Promega (1 mentions) Mirus transit lt1 reagent, by Mirus Bio (1 mentions) Opti mem reduced serum media, by Thermo Fisher Scientific (1 mentions)

4 protocols using lenti x 293t cells

1

Lentiviral Knockdown of Target Genes

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Gene KD was performed similar to as we previously described (Velazco-Cruz et al., 2019 (link)). pLKO.1 TRC plasmids containing shRNA sequences targeting GFP (sh-ctrl) and human SIX2 (sh-SIX2–1 and sh-SIX2–2) were received from the RNAi Core at the Washington University. sh-ctrl, GCGCGATCACATGGTCCTGCT; sh-SIX2–1, CAACGAGAACTCCAATTCTAA; sh-SIX2–2, GAGCACCTTCACAA GAATGAA. Viral particles were generated using Lenti-X 293T cells (Takara; 632180) cultured in DMEM (MilliporeSigma; D6429) with 10% heat inactivated fetal bovine serum (MilliporeSigma; F4135). Confluent Lenti-X 293T cells were transfected with 6 μg of shRNA plasmid, 4.5 μg of psPAX2 (Addgene; 12260), and 1.5 μg pMD2.G (Addgene; 12259) packaging plasmids in 600 μL of Opti-MEM (Life Technologies;31985–070) and 48 μL of Polyethylenimine ‘Max’ MW 40,000 Da (Polysciences; 24765–2). 16 hours post transfection media was switched. Viral containing supernatant was collected at 96 hours post transfection and concentrated using Lenti-X concentrator (Takara; 631232). Collected lentivirus was tittered using Lenti-X qRT-PCR Titration Kit (Takara; 631235). Lentiviral transduction occurred on the first day of Stage 6 by seeding 5 million dispersed single cells were into a well of a 6-well plate with lentivirus particles MOI of 5, media was switched 16 hours post transduction. psPAX2 and pMD2.G were a gift from Didier Trono.
Velazco-Cruz L., Goedegebuure M.M., Maxwell K.G., Augsornworawat P., Hogrebe N.J, & Millman J.R. (2020). SIX2 Regulates Human β Cell Differentiation from Stem Cells and Functional Maturation In Vitro. Cell reports, 31(8), 107687.
+ Open protocol
+ Expand
2

Lentiviral Knockdown of Target Genes

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Gene KD was performed similar to as we previously described (Velazco-Cruz et al., 2019 (link)). pLKO.1 TRC plasmids containing shRNA sequences targeting GFP (sh-ctrl) and human SIX2 (sh-SIX2–1 and sh-SIX2–2) were received from the RNAi Core at the Washington University. sh-ctrl, GCGCGATCACATGGTCCTGCT; sh-SIX2–1, CAACGAGAACTCCAATTCTAA; sh-SIX2–2, GAGCACCTTCACAA GAATGAA. Viral particles were generated using Lenti-X 293T cells (Takara; 632180) cultured in DMEM (MilliporeSigma; D6429) with 10% heat inactivated fetal bovine serum (MilliporeSigma; F4135). Confluent Lenti-X 293T cells were transfected with 6 μg of shRNA plasmid, 4.5 μg of psPAX2 (Addgene; 12260), and 1.5 μg pMD2.G (Addgene; 12259) packaging plasmids in 600 μL of Opti-MEM (Life Technologies;31985–070) and 48 μL of Polyethylenimine ‘Max’ MW 40,000 Da (Polysciences; 24765–2). 16 hours post transfection media was switched. Viral containing supernatant was collected at 96 hours post transfection and concentrated using Lenti-X concentrator (Takara; 631232). Collected lentivirus was tittered using Lenti-X qRT-PCR Titration Kit (Takara; 631235). Lentiviral transduction occurred on the first day of Stage 6 by seeding 5 million dispersed single cells were into a well of a 6-well plate with lentivirus particles MOI of 5, media was switched 16 hours post transduction. psPAX2 and pMD2.G were a gift from Didier Trono.
Velazco-Cruz L., Goedegebuure M.M., Maxwell K.G., Augsornworawat P., Hogrebe N.J, & Millman J.R. (2020). SIX2 Regulates Human β Cell Differentiation from Stem Cells and Functional Maturation In Vitro. Cell reports, 31(8), 107687.
+ Open protocol
+ Expand
3

Lenti-X 293T Cell-Mediated Lentivirus Production

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lenti-X 293T cells (Clontech Laboratories no. 632180) cultured in DMEM + 10% FBS + 1× Pen/Strep were used to produce VSV-G pseudotyped lentivirus with a second-generation lentiviral system. Genes of interest were cloned into transfer plasmid pPKm-145 (Addgene no. 90505), which was cotransfected into Lenti-X-293T cells with envelope plasmid pCMV-VSV-G (Addgene no. 8454) and packaging plasmid pCMVΔR8.2 (Addgene no.12263) at a 2:1:1 molar ratio using the ProFection Mammalian Transfection System (Promega, Madison, WI no. E1200). Viral supernatant was collected and filtered (0.22 μm) 48 h after transfection and either used directly or concentrated 100× using PEG-it Virus Precipitation Solution (System Biosciences, Palo Alto, CA) before use. Excess virus was aliquoted and stored at −80 °C for future use.
Allen M.E., Zhou W., Thangaraj J., Kyriakakis P., Wu Y., Huang Z., Ho P., Pan Y., Limsakul P., Xu X, & Wang Y. (2019). An AND-Gated Drug and Photoactivatable Cre-loxP System for Spatiotemporal Control in Cell-Based Therapeutics. ACS synthetic biology, 8(10), 2359-2371.
+ Open protocol
+ Expand
4

SARS-CoV-2 Lentiviral Knockdown Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
On day 0, Lenti-X 293T cells (Takara Bio) were seeded to 1:6 from a 100 mm dish into a 150 mm dish. The following day, Lenti-X 293T cells were transfected with 27.18 μg of SARS-CoV-2 reporter, 23.76 μg of dR8.91 and 2.97 μg of pMD2.G (Addgene) in 4.5 mL of Opti-MEM reduced serum media (GIBCO) with 150 μL of Mirus TransIT-LT1 reagent. 30,000 Cas13d A549 or wild-type A549 cells were also seeded in 24-well plates. On day 2, A549 cells were transfected with pools of targeting crRNAs or a non-targeting guide (50 μL Opti-MEM reduced serum media, 0.5 μg crRNA pool, 1 μL Mirus LT1 per well). On day 3, lentiviruses were harvested from the supernatant with a sterile syringe and filtered through a 0.22-μm polyvinylidene fluoride filter and precipitated with lentivirus precipitation solution and resuspended in 7 mL DMEM media. The media on the cells was replaced with either fresh media for the compensation controls or 0.5 mL virus-containing media at the following dilutions for the experimental conditions: undiluted, 1/2 dilution, 1/3 dilution, and 1/4 dilution. On day 4, the media on all the cells was replaced with 0.5 mL fresh DMEM. On day 5, cells were measured by flow cytometry and assessed for GFP knockdown. Statistical analyses were done using a two-sided t test with unequal variance in Excel to calculate p values.
Abbott T.R., Dhamdhere G., Liu Y., Lin X., Goudy L., Zeng L., Chemparathy A., Chmura S., Heaton N.S., Debs R., Pande T., Endy D., La Russa M.F., Lewis D.B, & Qi L.S. (2020). Development of CRISPR as an Antiviral Strategy to Combat SARS-CoV-2 and Influenza. Cell, 181(4), 865-876.e12.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!