Guide rna

Manufactured by Synthego

Sourced in United States

Guide RNA is a synthetic RNA molecule that is used in CRISPR gene editing technology. It serves as a targeting component, guiding the Cas9 enzyme to the desired DNA sequence for precise genome modification.

Automatically generated - may contain errors

Lab products found in correlation

Homologous recombination dna repair template, by Integrated DNA Technologies (2 mentions) Hr dna repair template, by TriLink (2 mentions) Cas9 mrna, by TriLink (2 mentions) P3 primary cell 4d nucleofector x kit s, by Lonza (2 mentions) Y 27632, by Selleck Chemicals (2 mentions) Dneasy blood and tissue kit, by Qiagen (2 mentions) Lipofectamine rnaimax, by Thermo Fisher Scientific (2 mentions) Cas9 protein, by Aldevron (1 mentions) Geneart crispr nuclease mrna, by Thermo Fisher Scientific (1 mentions) Mirneasy micro kit, by Qiagen (1 mentions) Truecut v2, by Thermo Fisher Scientific (1 mentions) Neon system, by Thermo Fisher Scientific (1 mentions) Sanger sequencing, by Eurofins (1 mentions) Stemfit, by Selleck Chemicals (1 mentions) Neon transfection system, by Thermo Fisher Scientific (1 mentions)

10 protocols using guide rna

CRISPR-Cas9 Targeting of COL7A1, TRAC, and AAVS1

Check if the same lab product or an alternative is used in the 5 most similar protocols

Guide RNAs were obtained from Synthego (Redwood City, CA, USA) and were used at a concentration of 1 μg with 10 μg of Cas9 protein (Aldevron, Fargo, ND, USA) or 1 μg of mRNA (TriLink, San Diego, CA, USA). Guide RNA target sequences (5′-3′) were:

COL7A1-1: GGCAGUAAAAGCCGUCAGCU

COL7A1-2: GCGGACGCGCAGGCAAGACC

COL7A1-3: AGAAAAGUCCCUGAUCUCGG

TRAC: GAGAAUCAAAAUCGGUGAAU

AAVS1: GUCACCAAUCCUGUCCCUAG

Osborn M.J., Lees C.J., McElroy A.N., Merkel S.C., Eide C.R., Mathews W., Feser C.J., Tschann M., McElmury R.T., Webber B.R., Kim C.J., Blazar B.R, & Tolar J. (2018). CRISPR/Cas9-Based Cellular Engineering for Targeted Gene Overexpression. International Journal of Molecular Sciences, 19(4), 946.

+ Open protocol

+ Expand

CRISPR Correction of NF1 Mutation

Check if the same lab product or an alternative is used in the 5 most similar protocols

We collected peripheral blood mononuclear cells from four individuals (aged <18 years), who had previously been diagnosed with NF1. The cells were reprogrammed with non-integrating Sendai virus into iPSC lines, which expressed pluripotency markers and were karyotypically normal. The GT duplication (c.3431_3432dupGT) in Exon 26 of individual #2 was identified by sequencing of the NF1 locus.
Guide RNAs (Synthego) were designed to a) directly bind to the site of the mutation (GGCATCACTGAGGCACTGTA), and b) span part of the GAP domain of the NF1 gene (TCCATGCAGACTCTCTTCCG or GCTAACATGTTGCCAATCAG). Two guide pairs were tested and overall 83 clones were isolated. Successful introduction of the large deletion was assessed by PCR, and the intact mutant allele carrying the germ line mutation was confirmed by sequencing. 5 clones were selected and expanded: 1 unedited, 1 carrying an indel mutation in the wild-type allele, and 3 carrying deletions in the wild-type allele. IPSC generation and genome-editing was performed in collaboration with the Harvard Stem Cell and Regenerative Biology (HSCRB) iPS Core.

Lakes Y.B., Moye S.L., Mo J., Tegtmeyer M., Nehme R., Charlton M., Salinas G., McKay R.M., Eggan K, & Le L.Q. (2023). Econazole selectively induces cell death in NF1-homozygous mutant tumor cells. Cell Reports Medicine, 4(12), 101309.

+ Open protocol

+ Expand

CRISPR Knockout Efficiency Screening

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Guide RNAs were ordered from Synthego (Table S2). Three Guide RNAs were designed per target using Benchling and Indelphi (Shen et al., 2018 (link)). Guides with predicted high on-target (>40), off-target (>80) and frameshift (>80%) scores were selected, preferentially targeting an early exon of the gene. Their KO efficiency was first assessed in cells. The guide yielding the highest KO per gene was taken forward for use in organoids.
Primers were designed on Primer 3 so that the target region is 150 bp upstream and downstream from the expected edit site to allow successful comparison of Sanger sequencing traces, with products ranging from 500 bp to 800 bp (Table S2).

Skoufou-Papoutsaki N., Adler S., D'Santos P., Mannion L., Mehmed S., Kemp R., Smith A., Perrone F., Nayak K., Russell A., Zilbauer M, & Winton D.J. (2023). Efficient genetic editing of human intestinal organoids using ribonucleoprotein-based CRISPR. Disease Models & Mechanisms, 16(10), dmm050279.

+ Open protocol

+ Expand

CRISPR-Cas9 Flag-Knockin Mice Generation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Flag-knockin mice were generated using CRISPR-Cas9-mediated genome editing. Guide RNA was designed and ordered from Synthego (Redwood City, California, USA), guide for flag-knockin mice (5´ ACGTTTGGCACTAAGCTCTT AGG 3´). Homologous recombination (HR) DNA repair template was ordered from Integrated DNA Technologies (IDT, Coralville, Iowa, USA), template for flag-knockin mice (5´TCTGCATGTGGTTTTTATGGGGTTTTCCTTCATCGTTCTTTGTGAATCTCCTAAGAGCTGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACGATGACAAGGCTTAGTGCCAAACGTATCCTAGGGAAACAGGTAGCTTGTTTTCTAAAAAGCTTGAGTAGAAA3´). Embryo microinjection into FVBxB62J F1 hybrid zygotes was performed as previously described^{27 (link)}, using 50 ng/ul of sgRNA, 25 ng/ul of HR DNA repair template, 50 ng/ul of Cas9 mRNA (TriLink Biotechnologies) and 50 ng/ul of Cas9 HiFi protein (IDT). We genotyped the flag-knockin mice using the primer sets, loci12F430, 5´GTCAGTGCTCACTTGGGATATG3´, and Flag_Rev, 5ĆCTTGTCATCGTCATCCTTGTA3´, which yield a 390bp amplicon.

Sun Y.H., Zhu J., Xie L.H., Li Z., Meduri R., Zhu X., Song C., Chen C., Ricci E.P., Weng Z, & Li X.Z. (2020). Ribosomes guide pachytene piRNA formation on long intergenic piRNA precursors. Nature cell biology, 22(2), 200-212.

+ Open protocol

+ Expand

CRISPR-mediated Knockdown of mOct4pg9

Check if the same lab product or an alternative is used in the 5 most similar protocols

We designed three single guide RNAs against non-overlapping regions of the mOct4pg9 coding region (Sequences in Supplementary File 1c). We assessed the efficiency and specificity of each of the sgRNAs by measuring both mOct4pg9 lncRNA and its host gene, Sik3, using RT-PCR. We selected the guide RNA with the highest mOct4pg9 knockdown and the least effect on Sik3 for CRISPR mediated knockdown in our experiments. sgRNA-2 met our criteria of the highest knockdown of mOct4pg9 with the least effect on Sik3 mRNA (Supplementary File 1d, average knockdown of mOct4pg9 RNA, 44.13±7.59% (t₍₂₂₎=5.812,p=0.000008), compared to average knockdown of Sik3 host-gene mRNA, 21.50±9.51% (t₍₂₂₎=2.26 p=0.034)). Neurospheres were dissociated into single cells, filtered through 100 μm filter, diluted to 2X10⁵ cells/ml of media and 500 μl of the cell suspension was plated into each well of a 6-well plate. 30 pmol of the guide RNA (Synthego, Redwood City, CA) and 0.5 μl of Geneart CRISPR nuclease mRNA (Thermo Fisher Scientific) was transfected into each well using lipofectamine RNAiMAX (Thermo Fisher Scientific). After 48 hours, cells were harvested and RNA was isolated using miRNeasy micro kit (Qiagen,). DNase treatment, cDNA synthesis and RT PCR were performed as described above.

Salem N.A., Mahnke A.H., Tseng A.M., Garcia C.R., Jahromi H.K., Geoffroy C.G, & Miranda R.C. (2020). A novel Oct4/Pou5f1-like non-coding RNA controls neural maturation and mediates developmental effects of ethanol.. Neurotoxicology and teratology, 83, 106943.

+ Open protocol

+ Expand

Efficient CRISPR-Cas9 Editing of Tregs

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Two days after activation with anti-CD3/28 beads and 1,000 IU/ml IL-2, Tregs were debeaded and electroporated with Cas9 (TrueCut v2, ThermoFisher Scientific) and guide RNA (Synthego, Redwood City, CA) ribonucleoprotein complexes (RNP) using a Neon system (ThermoFisher Scientific) with settings 2200 V, 20 ms, 1 pulse. Electroporated cells were recovered in antibiotic-free RPMI10 with IL-2 and expanded until analysis. The guide RNA sequence used to target the PRF1 gene (encoding the perforin protein) was 5’-CCTTCCCAGTGGACACACAA-3’. Control wild-type (WT) cells were electroporated with Cas9 alone. CRISPR/Cas9 genome editing efficiency was assessed by PCR amplification of a 500 bp region of the genomic DNA containing the PRF1 gRNA cutting site, using the forward primer 5’-AAGGGAGCAGTCATCCTCCA-3’ and the reverse primer 5’-CATTGCTGGTGGGCTTAGGA-3’, followed by Sanger sequencing (Eurofins Genomics, Louisville, KY) and sequence analysis using Tracking of Indels by Decomposition (TIDE, https://tide.nki.nl/) to obtain indel frequency ^{56 (link)}.

Cochrane R.W., Robino R.A., Granger B., Allen E., Vaena S., Romeo M.J., de Cubas A.A., Berto S, & Ferreira L.M. (2024). High affinity chimeric antigen receptor signaling induces an inflammatory program in human regulatory T cells. bioRxiv.

+ Open protocol

+ Expand

Efficient CRISPR-Cas9 Editing of iPSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

To prepare the Sp.HiFi Cas9 ribonucleoprotein (RNP) complex, 240 pmol of guide RNA (IDT) was mixed with 120 pmol of Hi-Fi SpCas9 protein (Macrolab) and incubated for 30 min at room temperature. For the Sa.KKH Cas9 RNP complex, 240 pmol of guide RNA (Synthego) was mixed with 120 pmol of Sa.KKH Cas9 protein (Macrolab). The gRNA sequences are listed in Supplementary Table 2. After dissociation with Accutase, 3.5 × 10⁵ cells were resuspended in P3 buffer and mixed with the RNP complex. The iPSCs were transfected using the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza, V4XP-3032) with pulse code DS138. After nucleofection, cells were incubated for 5 min at room temperature and then plated in Stemfit with 10-μM Y-27632 (SelleckChem). Genomic DNA was extracted from edited and unedited cells 3 days post-nucleofection using the DNeasy Blood and Tissue Kit (Qiagen). PCRs were performed with primers spanning the gRNA binding site (Supplementary Table 1), and the PCR products were sequenced. The indel frequency at the cut site was determined using Synthego ICE software, which compares the Sanger sequencing traces from the edited and unedited populations (Supplementary Figure 2).

Feliciano C.M., Wu K., Watry H.L., Marley C.B., Ramadoss G.N., Ghanim H.Y., Liu A.Z., Zholudeva L.V., McDevitt T.C., Saporta M.A., Conklin B.R, & Judge L.M. (2021). Allele-Specific Gene Editing Rescues Pathology in a Human Model of Charcot-Marie-Tooth Disease Type 2E. Frontiers in Cell and Developmental Biology, 9, 723023.

+ Open protocol

+ Expand

CRISPR-Cas9 Flag-Knockin Mice Generation

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

CRISPR-mediated STAT1 G-quadruplex disruption

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Huh7 and HepaRG cells were used to introduce indels targeting essential nucleotides of the G-quadruplex structure in 5′UTR region of STAT1 gene.^{33 (link)} Ribonucleoprotein of Cas9–2NLS (10 pmol) and guide RNA (50 pmol, Synthego) were loaded onto a 10 μL Neon Tip and electroporated into 1×10⁵ Huh7 and HepaRG cells, using Neon Transfection System at 1200 V, for 20 ms and four pulses (ThermoFisher Scientific), according to manufacturer’s instructions. Genomic DNA was isolated and used for rapid PAGE genotyping^{34 (link)} to validate incorporation of indels, 48 hours after electroporation. Validated pools of cells were subjected to clonal selection. Isolated single colonies were confirmed by rapid PAGE genotyping and allelic sequencing.

Sun J., Wu G., Pastor F., Rahman N., Wang W.H., Zhang Z., MERLE P., Hui L., Salvetti A., Durantel D., Yang D, & Andrisani O. (2021). RNA helicase DDX5 enables STAT1 mRNA translation and interferon signalling in hepatitis B virus replicating hepatocytes. Gut, 71(5), 991-1005.

+ Open protocol

+ Expand

Genome Editing of iPSCs Using Cas9 RNPs

Check if the same lab product or an alternative is used in the 5 most similar protocols

To prepare the Sp.HiFi Cas9 RNP complex, 240 pmol of guide RNA (IDT) was mixed with 120 pmol of Hi-Fi SpCas9 protein (Macrolab) and incubated for 30 min at room temperature. For the Sa.KKH Cas9 RNP complex, 240 pmol of guide RNA (Synthego) was mixed with 120 pmol of Sa.KKH Cas9 protein (Macrolab). The gRNA sequences are listed in Supplementary Table 2. After dissociation with Accutase, 3.5 x 10 5 cells were resuspended in P3 buffer and mixed with the RNP complex. The iPSCs were transfected using the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza, V4XP-3032) with pulse code DS138. After nucleofection, cells were incubated for 5 min at room temperature and then plated in Stemfit with 10 µM Y-27632 (SelleckChem). Genomic DNA was extracted from edited and unedited cells 3 days post nucleofection using the DNeasy Blood and Tissue Kit (Qiagen). PCRs were performed with primers spanning the gRNA binding site (Supplementary Table 1), and the PCR products were sequenced. The indel frequency at the cut site was determined using Synthego ICE software, which compares the Sanger sequencing traces from the edited and unedited populations (Supplementary Fig. S2).

Feliciano C.M., Wu K., Watry H.L., Marley C.B.E., Ramadoss G.N., Ghanim H.Y., Liu A.Z., Zholudeva L.V., McDevitt T.C., Saporta M., Conklin B.R., & Judge L.M. (2021). Allele-specific gene editing rescues pathology in a human model of Charcot-Marie-Tooth disease type 2E.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!