Pcdna3.1 pten

Manufactured by GenePharma

Sourced in China

PcDNA3.1-PTEN is a plasmid vector used in molecular biology research. It contains the gene encoding the PTEN protein, which is a tumor suppressor involved in regulating cell growth and division. The plasmid can be used for the expression and study of the PTEN protein in various cell lines.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions) Pcdna3.1 control, by GenePharma (1 mentions) Lipofectaminetm 3000 reagent, by Thermo Fisher Scientific (1 mentions) Pten sirna, by RiboBio (1 mentions) Pcdna3.1 c myc, by GenePharma (1 mentions) C myc sirna, by RiboBio (1 mentions) Lipofectamine 3000 transfection reagent, by Thermo Fisher Scientific (1 mentions) Sh nc, by GenePharma (1 mentions) Mir 328 3p mimic, by GenePharma (1 mentions) Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions) Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions) Hyclone, by Cytiva (1 mentions) Mimic nc, by GenePharma (1 mentions) Pcdna3.1 yap, by GenePharma (1 mentions) Gene specific sirna, by GenePharma (1 mentions) Lipofectamine rnaimax, by Thermo Fisher Scientific (1 mentions)

6 protocols using pcdna3.1 pten

Suppressing SOX2-OT Expression in BEAS-2B Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

To suppress SOX2-OT expression, antisense oligonucleotides, ASOs (small single-stranded nucleic acids that bind to SOX2-OT inside the cells), targeting SOX2-OT were designed and synthesized by RiboBio company (Guangzhou, China).
When BEAS-2B cells plated into 6-well plates or 24-well plates grew to 80% confluence, they were transfected with SOX2-OT-targeting ASO (ASO-SOX2OT), negative control ASO (ASO-NC), negative control miR (miR-NC), miR-455-3p mimic (miR-mimic), miR-455-3p inhibitor (miR-inhibitor), pcDNA3.1-control (pcDNA-Con) or pcDNA3.1-PTEN (Genepharma Co.Ltd., Shanghai, China) by Lipofectamine^TM 3000 reagent (Invitrogen) according to manufacturer’s instructions for 48 h [11–13 (link)]. After the transfection efficiency was verified by quantitative real-time PCR (qRT-PCR), the cells were collected and used for further analyses.

Yi C., Gu T., Li Y, & Zhang Q. (2022). Depression of long non-coding RNA SOX2 overlapping transcript attenuates lipopolysaccharide-induced injury in bronchial epithelial cells via miR-455-3p/phosphatase and tensin homolog axis and phosphatidylinositol 3-kinase/protein kinase B pathway. Bioengineered, 13(5), 13643-13653.

+ Open protocol

+ Expand

Constructing Expression Vectors for HBV Studies

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The expression vector of pcDNA3.1-HBx was constructed by inserting HBx DNA fragments into pcDNA3.1 vector [17 (link)]. The 1.3 fold HBV genome (genotype C) fragment was amplified from pGEM-HBV1.3, and the amplified 1.3 fold HBV genome fragments was cloned into pcDNA3.1 plasmid for the construction of pcDNA3.1-HBV plasmid [18 (link)]. The expression vectors of pcDNA3.1-PTEN, pcDNA3.1-cylcin G1, and pcDNA3.1-c-myc were purchased from Genepharma (Shanghai, China). HBx-siRNA, PTEN-siRNA, cyclin G1-siRNA and c-myc-siRNA was used to produce small interfering RNAs targeting HBx mRNA, PTEN mRNA, and cyclin G1 mRNA and c-myc mRNA respectively; miR-19a inhibitor was used to reduce the expression level of miR-19a, miR-122 and miR-223 mimics were used to increase the expression levels of miR-122 and miR-223, respectively; siRNA duplexes and miRNAs with non-specific sequences were designed as negative control (NC) (Ribobio, Guangzhou, China).

Yu G., Chen X., Chen S., Ye W., Hou K, & Liang M. (2016). MiR-19a, miR-122 and miR-223 are differentially regulated by hepatitis B virus X protein and involve in cell proliferation in hepatoma cells. Journal of Translational Medicine, 14, 122.

+ Open protocol

+ Expand

Modulation of PTEN Expression via miR-4262

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells in the logarithmic growth phase were subjected to cell transfection. Transient transfection of the cells with miR-4262 mimics, miR-4262 inhibitor and its NC control (Invitrogen) was conducted using Lipofectamine^™ 3000 transfection reagent (Thermo Fisher Scientific, Waltham, MA, USA). The recombinant plasmid pcDNA3.1-PTEN was synthesized by GenePharma (Shanghai, China). The plasmids were verified using DNA sequencing and the verified vectors were further amplified for subsequent experiments. Briefly, cells were precultured to approximately 50% confluence and then transfected with the pcDNA3.1 vector or pcDNA3.1-PTEN using Lipofectamine 3000 according to the manufacturer's instructions. After 12 h of transfection, fresh medium was added to the plates for cell culture. The sequence of the miR-4262 mimics is 5′-GACAUUCAGACUACCUG-3′.

Sun H., Zhou X., Bao Y., Xiong G., Cui Y, & Zhou H. (2019). Involvement of miR-4262 in paclitaxel resistance through the regulation of PTEN in non-small cell lung cancer. Open Biology, 9(7), 180227.

+ Open protocol

+ Expand

Plasmid-Mediated Knockdown and Overexpression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The short hairpin RNAs (shRNAs) specifically against LINC01559, EZH2, PGK1 and relative control shRNAs (sh-NC), along with pcDNA3.1/LINC01559, pcDNA3.1/PTEN and relative control pcDNA3.1 vectors, all these plasmids were produced by Genepharma (Shanghai, China). The miR-1343-3p mimics and NC mimics were also from Genepharma. Cell transfection with indicated plasmids was conducted for 48 h with Lipofectamine 2000 (Invitrogen).

Wang L., Bo X., Yi X., Xiao X., Zheng Q., Ma L, & Li B. (2020). Exosome-transferred LINC01559 promotes the progression of gastric cancer via PI3K/AKT signaling pathway. Cell Death & Disease, 11(9), 723.

+ Open protocol

+ Expand

Overexpression of miR-328-3p and PTEN in hFOB1.19 osteoblasts

Check if the same lab product or an alternative is used in the 5 most similar protocols

A human osteoblast cell line hFOB1.19 was purchased from the Chinese Academy of Sciences Cell Bank. The cells were cultured in RPMI-1640 (HyClone; Cytiva) medium supplemented with 10% FBS (Invitrogen; Thermo Fisher Scientific, Inc.), 1,000 U/ml penicillin and 100 µg/ml streptomycin in an incubator with 5% CO₂ at 37˚C.
To overexpress miR-328-3p in hFOB1.19, 50 nM miR-328-3p mimic (5'-CUGGCCCUCUCUGCCCUUCCGU-3') was synthesized by Shanghai GenePharma Co., Ltd. and transfected into cells using Lipofectamine^® 3000 (Invitrogen; Thermo Fisher Scientific, Inc.) following the manufacturer's instructions. The negative control for the mimic (mimic NC; 50 nM; Shanghai GenePharma Co., Ltd.; 5'-UUCUCCGAACGUGUCACGU-3') was used and transfected into hFOB1.19 to serve as a negative control group. Additionally, the overexpression vector of PTEN, pcDNA3.1-PTEN (Shanghai GenePharma Co., Ltd.), was synthesized and transfected into hFOB1.19 to overexpress PTEN in osteoblasts. The cells transfected with only transfection reagent were set as the mock group. Cell transfection was performed at 37˚C for 6 h, the transfection regent was removed and fresh RPMI-1640 medium was added. After 48 h of cell transfection, cells were used for subsequent experimentation. All experiments were repeated in triplicate.

Xie W., Wang Z., Zhang Y, & Zhang Z. (2020). Beneficial role of microRNA-328-3p in fracture healing by enhancing osteoblastic viability through the PTEN/PI3K/AKT pathway. Experimental and Therapeutic Medicine, 20(6), 271.

+ Open protocol

+ Expand

Modulating YAP and PTEN in Lung Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human gene expression plasmids pcDNA3.1-YAP, pcDNA3.1-PTEN, gene-specific siRNAs, gene-specific shRNAs and control were from GenePharma (Shanghai, China). The target sequences were as follows: shPTEN1: GTCTGACCTAGTTAATTTACA; shPTEN2: GCAGGCTTCCAAAGGCTTATG; siYAP1: CUGCCACCAAGCUAGAUAATT; siYAP2: GCCAGUACUGAUGCAGGUATT; siLATS: GGUAGUUCGUCUAUAUUAUTT. Transfection of plasmids into A549 and H1299 cells were carried out using Lipofectamine 2000 (Invitrogen, USA) according to the manufacturers’ instructions. Lipofectamine RNAiMAX (Invitrogen, USA) was used to transfect siRNAs.

Xu W., Zhang M., Li Y., Wang Y., Wang K., Chen Q., Zhang R., Song W., Huang Q., Zhao W, & Wu J. (2021). YAP manipulates proliferation via PTEN/AKT/mTOR-mediated autophagy in lung adenocarcinomas. Cancer Cell International, 21, 30.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!