Formaldehyde

Cells were grown in 12-well plates with 18-mm round coverslips until ∼80% confluent. Coverslips were washed with microtubule stabilizing buffer (MTSB; 100 mM 1,4-piperazinediethanesulfonic acid, pH 6.9, 30% glycerol, 1 mM ethylene glycol tetraacetic acid, and 1 mM MgSO₄) and fixed with precooled methanol at −20°C for 5 min or 4% formaldehyde or 0.5% glutaraldehyde (Tousimis, Rockville, MD) in MTSB at room temperature for 10 min. glutaraldehyde was quenched with 0.2% NaBH₄ for 20 min. Coverslips were washed twice with PBS and blocked in triton block (0.2 M glycine, 2.5% FBS, and 0.1% Triton X-100 in PBS) at 4°C. For formaldehyde and glutaraldehyde fixations, cells were preextracted with 0.5% Triton X-100 in MTSB for 1–5 min at 37°C. Primary antibody dilutions were as for immunoblots except for Bub1 (1:200), Aurora B (1:2500), and α-tubulin (YL1/2; 1:500). Images were acquired on a Nikon Eclipse Ti-E inverted fluorescence microscope using a CoolSNAP HQ2 camera and a 100×/1.4 numerical aperture (NA) oil objective. Chromosome spread images are from a single z. Other images are maximum projections of 0.2-μm z-stacks deconvolved using the AQI module in Nikon Elements unless otherwise indicated.

Wild-type or Atf4^−/− MEFs (2 × 10⁷) were fixed for 10 min in 1% formaldehyde (Tousimis), and this reaction was quenched by incubation for 5 min in 0.125 M glycine. Nuclear pellets were lysed in 10 mM Tris (pH 8.0), 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 0.1% sodium deoxycholate, and 0.5% N-laurylsarcosine and sheared for 30 min (30 sec on, 30 sec off) in TPX microtubes using a Bioruptor bath sonicator (Diagenode). Complexes bearing ATF4 were captured with 5 µg of antibody (Santa Cruz Biotechnology, sc-200) bound to 50 µL of protein G Dynabeads (Life Technologies), washed five times in RIPA wash buffer (50 mM HEPES-KOH at pH 7.6, 300 mM lithium chloride, 1 mM EDTA, 1% NP-40 substitute, 0.7% sodium deoxycholate) and once in TE wash buffer (10 mM Tris at pH 8.0, 1 mM EDTA, 50 mM NaCl), and eluted in 0.1 M sodium bicarbonate/1% SDS. Cross-links were reversed by incubation overnight at 65°C followed by treatment with RNase A and proteinase K. DNA was isolated using PCR purification columns (Qiagen). Enrichment of ATF4 at target loci relative to input was determined by quantitative real-time PCR using the following primers: Sesn2 -3kb F (AGTGTTTGGTCAGGCAAGGT), Sesn2 -3kb R (TCAGTGGCTTTAACACGGCT), Sesn1 pr F (GATGACTGCTGGATTGCGGG), and Sesn1 pr R (AACCCTGCCGGTTCTTGTC).