Luciferase sirna

All siRNA were purchased from Dharmacon (Lafayette, CO, USA). Untreated cells and cells treated with nontargeted scrambled siRNA (Dharmacon, Catalog Item D-001810-10-20) or luciferase siRNA (Dharmacon, Catalog Item P-002099-01-50) were used as controls. Isoform-specific siRNAs were custom designed using Thermo Scientific siRNA Design Center (Thermo Scientific, Rockford, IL, USA). siRNA specific sequences were 5′-CAUGCUGUUCCAGUGCUCC-3′ for Chk-α, 5′-GAGGAAGACCUGAAGGUUCAGCAUA-3′ for PD-L1 #1, and 5′-CCUACUGGCAUUUGCUGAACGCAUU-3′ for PD-L1 #2.
Cells at 40 to 50% confluency were transfected with 100 nM of scrambled or luciferase siRNA, and with 50 nM or 100 nM of Chk-α- or PD-L1-specific siRNA for individual treatments. For combination siRNA treatments, 50 nM of each specific siRNA was used. Cells were treated with siRNA for 48 h because this incubation period resulted in the most effective downregulation of the target genes. D-FECT 4 (Dharmacon, Catalog Item T-2004-03) was used as the transfection agent for MDA-MB-231, Pa09C and Pa20C cells, and Lipofectamine 2000 (Thermo Fisher, Waltham, MA, USA, Catalog Item 11668019) for SUM-149 cells. All transfections were carried out based on established protocols [34 (link)].

The small interfering RNA (siRNA) for NudC (5’–AACACCTTCTTCAGCTTCCTT– 3’ NM-006600, nucleotides 204–224) (Dharmacon) was described previously [32 (link)–34 (link)]. Firefly (Photonius pyralis) luciferase siRNA was used as a control (Dharmacon). In initial experiments, cells were also co-transfected with siGLO RISC-free siRNA (Dharmacon), a fluorescent non-targeting control oligonucleotide, at a 10:1 siRNA:siGLO ratio, to mark siRNA uptake in transfected cells. HeLa cells (3 x 10⁴ cells) were plated onto poly-L-lysine coated 18-mm coverslips (Fisher Scientific) in a 12-well dish for immunofluorescence, using antibiotic-free OptiMEM (Invitrogen) supplemented with 10% FBS for 24 h. Appropriate siRNA (120 pmol) was diluted in 24 μl pure OptiMEM. In a separate tube, 6 μl Oligofectamine (Invitrogen) was diluted in 100 μl pure OptiMEM, incubated at room temperature for 5 min, added to the diluted siRNA mixture, and allowed to incubate for 20 min at room temperature. The siRNA mixture was then added to the cells and incubated for 72 h to ensure a good knockdown of NudC.

Osteoblasts were transfected with 100 pmol of siRNA specific for AFAP1 (pool of 4 siRNAs, GCGCCUUCCUGUUGCGUAA, UCACGUACAUCCCGAGAGA, CCAACAUCCUGCUUCGAAU, GAAAAGAGGCCCUGCGGAA, Dharmacon, Thermo Fisher Scientific, Pittsburgh, PA) or 100 pmol control Luciferase siRNA (CGUACGCGGAAUACUUCGAdTdT, Dharmacon) using Lipofectamine and Plus reagent (Invitrogen, Life Technologies, Carlsbad, CA) according to the manufacturer’s instructions.