Prset a bacterial expression vectors

PCR degenerate primers were designed with desired restriction sites to amplify trout saccular hair cell otoferlin C2F cDNA: upstream 5’-GCCGGATCCGACCWGCMATTGAYATWTC-3’ and downstream: 5’-TGCGAATTAGATSGARATGGTTGGCAGMTC-3’, based on Danio rerio sequence (GenBank accession no. NM_001030112.2) and Oreochromis niloticus otoferlin-like sequence (XM_003449855.1), with the hair cell sequence deposited in GenBank (accession no. KF644438 corresponding to rat otoferlin aa 1728–1861). The PCR products were digested with restriction enzymes and cloned into similarly digested pRSET-A bacterial expression vectors (Invitrogen). The plasmids were prepared in Escherichia coli JM109 cells (Promega). Selected clones were sequence-verified before expression and interaction studies.

It has been shown that AAK1 specifically phosphorylates threonine 156 of the μ-subunit of adapter protein-2 (AP2) complexes. In the present study, we used AAK1 to phosphorylate AP2mu1 in an in vitro kinase assay. We synthesized PCR primers with restriction sites (TGCGGATCCATGAAGAAGTTTTTCGACTCC, upstream, and GCCCCATGGTCAAGTAGCCTGGGCCTGGGTGGG, downstream) to amplify from rat OC partial cDNA for AAK1 (corresponding to aa 1–460 of 963, GenBank NP_001166921). Amino acids 1–460 of AAK1 encompass protein kinase functional sites, catalytic domain, active site, ATP-binding site, substrate-binding site, activation loop, and a serine/threonine domain (aa 1–312). The PCR product was digested with restriction enzymes and cloned into similarly digested pRSET-A bacterial expression vectors (Invitrogen). The plasmids were prepared in E. coli JM109 cells (Stratagene). Selected clones were sequence-verified before expression and phosphorylation studies.