Q5 high fidelity dna polymerase
The Q5 High-Fidelity DNA Polymerase is a thermostable, high-fidelity DNA polymerase enzyme used for PCR amplification of DNA fragments. It has enhanced proofreading activity, resulting in significantly lower error rates compared to standard Taq DNA polymerases.
3 protocols using q5 high fidelity dna polymerase
16S rRNA Gene Amplification and Sequencing Protocol
Genotyping Pup Genomic DNA by PCR
GCex8-2 (Sigma, USA) | GTACGTTCATGGCATTGCTGTTCACT |
METex8-2 (Sigma, USA) | ATTCCAGCTGTCCCTCGTCTCC |
NEO-AO2 (Sigma, USA) | AAGACAGAATAAAACGCACGGGTGTTGG |
98 °C | 30 s | ×15 |
98 °C | 10 s | |
63 °C (0.5 °C touchdown) | 30 s | |
72 °C | 1.30 min | |
98 °C | 10 s | ×25 |
61 °C | 30 s | |
72 °C | 1.30 min | |
72 °C | 5 mins | |
10 °C | Hold |
Construction and Verification of Plasmid Mutants
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!