Q5 high fidelity dna polymerase

PCR amplification of the 16S rRNA gene V4 region was performed according to method of Caporaso et al. [68 (link)]. Samples were amplified in triplicate using 0.25 μl Q5 High-Fidelity DNA Polymerase (NEB) per 25 μl reaction with 0.2 mM dNTPs (Sigma), 1X Q5 Reaction Buffer, 200 pM 515F primer (IDT), and 200 pM barcoded 806R primer (IDT) in PCR-Clean water (MoBio). A water-template negative control reaction was included with each sample to confirm absence of contaminating DNA. Samples were amplified at 98°C for 30 seconds, followed by 35 cycles of 98°C for 10 s, 60°C for 30 s, and 72°C for 20 s with a final 2 min extension at 72°C. Triplicate reactions were pooled and then separated on an agarose gel in parallel with the paired water control reactions to confirm successful amplification. Individual samples were pooled and purified using an UltraClean 96 PCR Cleanup Kit (Qiagen). The pooled library was then quantified, diluted, supplemented with 10% PhiX, chemically and heat denatured as per Illumina MiSeq protocols, and sequenced at 10 pM on an Illumina V2 1x300 sequencing kit using custom sequencing primers as per Caporaso [68 (link)].

Genomic DNA was extracted from liver for each pup (P0) using DNeasy Blood & Tissue Kit (Qiagen), genotyped by PCR using Q5 High Fidelity DNA Polymerase (NEB) and the following primers:

GCex8-2 (Sigma, USA)	GTACGTTCATGGCATTGCTGTTCACT
METex8-2 (Sigma, USA)	ATTCCAGCTGTCCCTCGTCTCC
NEO-AO2 (Sigma, USA)	AAGACAGAATAAAACGCACGGGTGTTGG

PCR was performed on T100 Thermal cycler (Biorad) using the following PCR cycling conditions. Bands were visualized by gel electrophoresis.

98 °C	30 s	×15
98 °C	10 s
63 °C (0.5 °C touchdown)	30 s
72 °C	1.30 min
98 °C	10 s	×25
61 °C	30 s
72 °C	1.30 min
72 °C	5 mins
10 °C	Hold

Sequence amplifications by PCRs were performed using Q5 High Fidelity DNA polymerase (NEB) and pairs of primers (Sigma–Aldrich) listed in Table S2. Plasmids were constructed using standard cloning techniques, as previously described (18 (link), 25 (link)). Point mutants on expression plasmids were obtained by Quick-change site-directed mutagenesis using complementary pairs of oligonucleotides (Table S2) and Pfu Turbo polymerase (Agilent). All constructs were confirmed by DNA sequencing (Eurofins, MWG).