Cells were labeled with either PKH-26 or with green florescent protein (GFP). For PKH-26 labeling, cells were dissociated by trypsin EDTA and then centrifuged, washed and incubated with PKH-26 [40 ] according to the recommended protocol by Sigma (PKH26GL, Sigma). Positive labeling was verified using fluorescence microscopy just before transplantation. For GFP labeling, viruses were produced by transient co-transfection of three plasmids into 293T cells as described earlier [41 (link),42 (link)], with several modifications. Briefly, 2 × 106 293T cells were transfected using the TransIT-293 Transfection Reagent (Mirus) with a total of 20μg of plasmid DNA: 3.5μg of the envelope plasmid pMD.G harboring the gene encoding VSV-G, 6.5μg of the packaging plasmid pCMVΔR8.91, and 10μg of the transfer vector expressing eGFP. The medium was replaced 24 hours after transfection with the MSC medium. The medium, which contains the viral particles, was collected 48 and 72 hours after transfection and filtered through 0.45-μm filters (Sartorius, Goettingen, Germany). The efficacy of the transfection was evaluated by FACS analysis.
Transit 293 transfection reagent mirus
Manufactured by Mirus Bio
TransIT-293 Transfection Reagent is a non-liposomal, cationic polymer-based transfection reagent designed for the efficient delivery of DNA, RNA, and other genetic materials into human embryonic kidney (HEK-293) cells.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using transit 293 transfection reagent mirus
1
Cell Labeling for Transplantation Studies
2
Generating RAF-knockout Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate RAF-knockout lines, clustered regularly interspersed short palindromic repeat (CRISPR) genome editing (27, 28) was used for all lines, except HCT 116. Guide sequences for ARAF (CCTGCCCAACAAGCAACGCA), BRAF (ATATCAGTGTCC-CAACCAAT), and CRAF (TGTTGCAGTAAAGATCCTAA) were synthesized using standard chemistry and cloned into in-house generated lentiviral expression vectors. Lentiviral vectors were packaged in 293T cells with TransIT-293 Transfection Reagent (Mirus, #MIR2700) using 5.4 mg of plasmid per 10-cm plate. Virus was harvested after 48 hours and passed through a 0.45-mm filter. Cell lines stably expressing Cas9 were incubated with lentivirus and 8 mg/mL Polybrene (Millipore, #TR-1003-G) for 24 hours, and subsequently cultured in media containing puromycin. Following selection in puromycin, reductions in target protein levels were assessed via immunoblotting and single clones with complete loss of target protein expression were isolated from pools via serial dilutions. HCT 116-knockout lines were generated in parental and BRAF À/À lines from Horizon Discovery by transfection with zinc finger mRNAs against ARAF, BRAF, and CRAF purchased from Sigma.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!