Plko tet on system

Two independent siRNAs were used to knock down SETDB1. The respective sequences are si-Q3: 5′- CAGCATGCGAATTCTGGGCAA -3′, si-Q4: 5′- TCGGGTGGTCGCCAAATACAA -3′, Ctrl-siRNA: siGLO RISC-Free Control siRNA (Dharmacon). siRNAs were transfected using Lipofectamine RNAiMAX (Invitrogen) and assayed for 3–5 days after transfection. The shRNA against p53 was ordered from Sigma (Clone ID: NM_000546.4-887s21c1). The sequence is: 5′- CCGGCACCATCCACTACAACTACATCTCGAGATGTAGTTGTAGTGGATGGTGTTTTTG -3′.
For inducible shRNA, the shRNA sequence was cloned into the single lentiviral-based Tet-on-inducible vector pLKO-Tet-on system (Sigma) as previously reported40 (link). The sequences of shRNAs that target SETDB1 are: sh1-5′: 5′- CCGGGTTCGGCTACAGCTATTCACTCGAGTGAATAGCTGTAGCCGAACTTTTT -3′; sh1-3′: 5′- AATTAAAAAGTTCGGCTACAGCTATTCACTCGAGTGAATAGCTGTAGCCGAAC -3′; sh2-5′: 5′- CCGGGATGTGAGTGGATCTATCGCTCGAGCGATAGATCCACTCACATCTTTTT -3′; sh2-3′: 5′- AATTAAAAAGATGTGAGTGGATCTATCGCTCGAGCGATAGATCCACTCACATC -3′. Each pair of shRNAs was annealed and inserted into the pLKO-Tet-on vector and co-transfected into 293T with pCG10 and pCG41. Cell supernatants were collected 48 h after transfection and passed through a 0.22-μm filter. Cells were infected with the virus supernatant and were cultured in medium containing 2 μg ml⁻¹ puromycin for stable cell line selection.