Custom morpholinos

Custom Morpholinos were purchased by Genetools LLC. The sequence used are the follow:
Tg2aMO: (5′-CTCAATTTCCACCACTCTCTCCATG-3′);
Tg2bMO: (5′-CCGATGTCCAGAGCCATGTTTATAA-3′);
Tg2lMO: (5′-TGATGGATTTAGCTTGACAAGTCGT-3′).
All morpholinos affect translational start of zebrafish TG2 paralogous genes. Standard Ctrl Morpholino (CtrlMO) was also purchased by Genetools LLC. Microinjection was performed on randomly separated sibling embryos at one-cell stage, adding ≈12 ng/embryos of morpholino. Morpholinos impeded either the translation of zTg2a, or zTg2b, or zTg2l transcripts, blocking both maternal and zygotic forms. Chorions were manually removed at 24 hpf (hpf: hours post fertilization) and images were acquired either at 30 or 48hpf, crude proteins extract were also obtained after image acquisition. zTg2b KD was performed by the injection of 0.05, or 0.1, or 0.2 pmol of antisense morpholino for embryo.

Custom morpholinos were purchased from Gene Tools LLC (Philomath, USA) and resuspended in autoclaved MilliQ water to a stock dilution of 20 μg/μl. Stock solutions were stored at -20° C to prevent evaporation and heated at 70° C for 5 min prior to dilution to eliminate precipitates. Wild-type embryos were injected into the yolk at the 1-cell stage with 5 ng/nl dilutions. Phenotypes were observed under the microscope at 3 dpf and 4 dpf. Volumes varied between 5 and 10 nl per embryo. Sequences of morpholino oligos can be found in S1 Table.

PMOs were designed in accordance with previously published work [12 (link)]. Briefly, NF1 exon 13 cryptic splice site was analyzed. PMOs were designed to physically bind and mask the site. Morpholino sequences include: M1: TGGACAAGAGAAGATACTTACAGCT; M2: GACAAGAGAAGATACTTACAGCTTC; and Control (Ctrl): CCTCTTACCTCAGTTACAATTTATA.
Custom Morpholinos were ordered from Gene Tools, LLC and reconstituted in 0.22 µM filtered ultrapure nuclease-free water, to make a 1 mM stock concentration, as per the manufacturer’s directions. WT or Y489C-containing PGP1 iPS cells at ~70–80% confluence were treated with PMOs diluted in 1 mL of fresh culture media at desired concentrations, alongside 6 µM of Endo-Porter (DMSO) (Gene Tools LLC). Cells were incubated at 37 ℃, 5% CO₂ for 48 h prior to harvest.