Non targeting sirna

The specificity of Plk4 antibodies was evaluated after siRNA depletion of Plk4. HeLa^C1-GFP cells were transfected with non-targeting siRNA (5′-UGG​UUU​ACA​UGU​CGA​CUA​A-3′; Dharmacon) or Plk4 siRNA (5′-GAA​AUG​AAC​AGG​UAU​CUA​A-3′; Dharmacon) using Oligofectamine (12252011; Invitrogen) following the vendor’s instructions. Cells were collected for immunolabeling after 40 h of siRNA depletion.
To deplete Cep152 and Cep192, G1 HeLa^C1-GFP cells were treated with Cep192 siRNA (5′-GCU​AGU​AUG​UCU​GAU​ACU​UGG-3′; Dharmacon), Cep152 siRNA (sc-90225; Santa Cruz), non-targeting siRNA (5′-UGG​UUU​ACA​UGU​CGA​CUA​A-3′; Dharmacon), or control siRNA-A (sc-37007; Santa Cruz) 2 h after shake-off as described above. Cells were treated with HU 27 h after shake-off, while in their second G1, and fixed in their second S phase 48 h after treatment with siRNA. In some experiments, ∼48 h after shake-off, cells were treated with CEN for 2 h to induce Plk4 accumulation and fixed, or they were treated with CEN transiently to allow the formation of centriolar rosettes after CEN washout (as depicted in Fig. 5 G).

Nontargeting siRNA was obtained from Dharmacon (catalog number: D0012100220). FDXR siRNA (FDXR si434) with the targeting sequence GCUCAGCAGCAUUGGGUAUAA was obtained from Dharmacon.
Lentiviral FDXR shRNAs were obtained from the Broad Institute TRC shRNA library. The target sequences are as follows:

Human follicular thyroid carcinoma cells (FTC-133 ; ECACC 94060901) were grown in Dulbecco's modified Eagle medium (DMEM)–Ham's F-12 medium (Dutscher, Brumath, France) supplemented with 10% fetal bovine serum (FBS), as previously described [59 (link)]. MDA-MB-231 (human breast cancer cells), COS-7 (kidney fibroblasts) and primary dermic fibroblast were cultured in DMEM plus 10% FBS. U87 (human glioblastoma cells) and MNT-1 (human melanoma cells) were grown in Minimum Essential Media (MEM, Dutscher) supplemented with 10% and 20% FBS, respectively. HUVECs (human umbilical vein endothelial cells) were cultured in complete endothelial growth medium (EGM-2, Lonza). FTC-133 cells were transiently transfected with LRP-1-derived mini-receptors or DSR-β1-ITG encoding plasmid using JetPEI reagent (Polyplus Transfection, Illkirch, France) according to manufacturer’s instructions. LRP-1 knockdown was achieved by RNA interference using a previously validated siRNA approach [20 (link)]. LRP-1 siRNA as well as non-targeting siRNA used as controls were purchased from Dharmacon (Lafayette, CO, USA) and transiently transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA), as reported [28 (link)].