Log In Sign up
The largest database of trusted experimental protocols

Perfecta qpcr fastmix 2

Manufactured by Quantabio
Visit Supplier
Sourced in Switzerland

PerfeCTa qPCR FastMix II is a ready-to-use reaction mixture for quantitative PCR (qPCR) applications. It is designed to provide robust and reliable performance for gene expression analysis, genotyping, and other qPCR-based assays.

Automatically generated - may contain errors

Lab products found in correlation

Qscript cdna supermix, by Quantabio (3 mentions) Tri reagent, by Thermo Fisher Scientific (2 mentions) Zr viral rna kit, by Zymo Research (2 mentions) Ribozol, by Avantor (2 mentions) Trizol reagent, by Thermo Fisher Scientific (2 mentions) Iq5 thermocycler, by Bio-Rad (1 mentions) Turbo dnase, by Thermo Fisher Scientific (1 mentions) Dna free kit, by Thermo Fisher Scientific (1 mentions) Improm 2 reverse transcriptase, by Promega (1 mentions) Taqman assay, by Thermo Fisher Scientific (1 mentions) Taqman gene expression assay, by Thermo Fisher Scientific (1 mentions) Direct zol rna microprep kit, by Zymo Research (1 mentions) Taqman ribosomal rna control reagent, by Thermo Fisher Scientific (1 mentions) M mulv reverse transcriptase, by New England Biolabs (1 mentions) Lightcycler 96, by Roche (1 mentions)

7 protocols using perfecta qpcr fastmix 2

1

Frozen Epididymal Adipose Tissue RNA Isolation and qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Frozen epididymal adipose tissue was homogenized in Tri-Reagent (Fisher) and total RNA was isolated using Direct-zol RNA MiniPrep kit (Genesee). cDNA synthesis was performed using qScript cDNA supermix (QuantaBio) using a BioRad iQ5 thermocycler. Real-time qPCR was performed using PerfeCTa qPCR FastMix II (QuantaBio) and mouse specific TaqMan assays (ThermoFisher) on a 7500 fast Dx thermocycler. The delta-delta CT method was used to determine relative gene expression normalized to 18s expression. Reactions were performed in duplicate.
Pal A., Sun S., Armstrong M., Manke J., Reisdorph N., Adams V.R., Kennedy A., Zu Y., Moustaid-Moussa N., Carroll I, & Shaikh S.R. (2021). Beneficial effects of eicosapentaenoic acid on the metabolic profile of obese female mice entails upregulation of HEPEs and increased abundance of enteric Akkermansia Muciniphila. Biochimica et biophysica acta. Molecular and cell biology of lipids, 1867(1), 159059.
+ Open protocol
+ Expand
2

Quantitative PCR Protocol for MNV Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA from tissues was extracted via RiboZol (VWR) protocols, and RNA from cells was extracted with the ZR Viral RNA kit (Zymoresearch, Irvine, CA). DNA contamination was removed with Turbo DNase (ThermoFisher), and 1ug of RNA was used to generate cDNA with the ImpromII reverse transcriptase (Promega, Madison, WI). Quantitative PCR was performed using PerfeCTa qPCR FastMix II (QuantaBio, Beverly, MA), and the following oligo/probes were used for detection: MNV genomic RNA—Forward primer CACGCCACCGATCTGTTCTG, Reverse primer GCGCTGCGCCATCACTC, and Probe TGCGCTTTGGAACAATGG; RPS29—Forward primer GCAAATACGGGCTGAACATG, Reverse primer GTCCAACTTAATG AAGCCTATGTC, and Probe CCTTCGCGTACTGCCGGAAGC.
Robinson B.A., Van Winkle J.A., McCune B.T., Peters A.M, & Nice T.J. (2019). Caspase-mediated cleavage of murine norovirus NS1/2 potentiates apoptosis and is required for persistent infection of intestinal epithelial cells. PLoS Pathogens, 15(7), e1007940.
+ Open protocol
+ Expand
3

Quantifying Virus and Immune Genes in Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA from tissues was isolated using RiboZol (Amresco) and RNA from cells or fluids was isolated using the ZR Viral RNA Kit (Zymoresearch). DNA contamination was removed using the DNAfree kit (Life Technologies). cDNA was generated with the ImPromII reverse transcriptase (Promega). Quantitative PCR was performed using PerfeCTa qPCR FastMix II (QuantaBio) ant the following primers and probes: MNV genomes - Forward primer CACGCCACCGATCTGTTCTG, Probe TGCGCTTTGGAACAATGG, Reverse primer GCGCTGCGCCATCACTC; Ifnb1 - Forward primer CTCCAGCTCCAAGAAAGGAC, Probe CAGGAGCTCCTGGAGCAGCTGA, Reverse primer GCCCTGTAGGTGAGGTTGAT; Ifnl2/Ifnl3 - Forward primer GGACCTGAAGCAGCTGCA, Probe GGCGCTCTTGGACCTGCAG, Reverse primer TTCTCCCAGACCTTCAGGGT; Ccl2 - Integrated DNA technologies (IDT) assay #Mm.PT.58.42151692; Il1a - IDT assay #Mm.PT.58.32778767. Absolute copy number was determined by comparing Ct values to a standard curve generated using DNA of known copy number encoding the target sequence. Samples are graphed as absolute copy number of the indicated target divided by absolute copy number of the housekeeping gene, Rps29. Samples with fewer than 1,000 copies of Rps29 were excluded.
Van Winkle J.A., Robinson B.A., Peters A.M., Li L., Nouboussi R.V., Mack M, & Nice T.J. (2018). Persistence of systemic murine norovirus is maintained by inflammatory recruitment of susceptible myeloid cells. Cell host & microbe, 24(5), 665-676.e4.
+ Open protocol
+ Expand
4

Liver RNA Isolation and qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
For RNA isolation, 25 mg of frozen liver tissue was homogenized in Tri-Reagent (Fisher) and extracted using Direct-zol RNA MiniPrep kit (Genesee) according to manufacturer’s instructions. cDNA was synthesized on a BioRad iQ5 thermocycler using qScript cDNA supermix (QuantaBio) according to manufacturer’s instructions. Real-time RT-PCR analysis was performed using PerfeCTa qPCR FastMix II (QuantaBio) and TaqMan assay (ThermoFisher) on a 7500 fast Dx thermocycler. Relative gene expression was normalized to 18s expression and determined using the delta-delta CT method. All sample reactions performed in duplicate. All TaqMan assays used can be found in STAR methods.
Adams V.R., Collins L.B., Williams T.I., Holmes J., Hess P., Atkins H.M., Scheidemantle G., Liu X., Lodge M., Johnson A.J, & Kennedy A. (2024). Myeloid cell MHC I expression drives CD8+ T cell activation in nonalcoholic steatohepatitis. Frontiers in Immunology, 14, 1302006.
+ Open protocol
+ Expand
5

Quantifying Gene Expression by qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Quantitative real-time polymerase chain reaction (qRT-PCR) was conducted using PerfeCTa qPCR FastMix II (QuantaBio) together with 6-FAM/ZEN/IBFQ primer/probe sets (PrimeTime qPCR Assays, IDT) and VIC-labeled TaqMan Ribosomal RNA Control Reagents (Applied Biosystems) on Roche LightCycler 96 according to manufacturers’ protocols. Triplicate samples from three independent mice were analyzed for each group. Relative gene expression was calculated using the formula 2^−[Ct(target gene)−Ct(18S)] where Ct refers to the cycle threshold.
Cooper P.O., Yang J., Wang H.H., Broman M.M., Awdalkreem G.D., Cresswell G.M., Wang L., Goossens E., Lanman N.A., Doerge R.W., Zheng F., Cheng L., Crist S.A., Braun R.E., Jerde T.J, & Ratliff T.L. (2023). Inflammation Impacts Androgen Receptor Signaling in Basal Prostate Stem Cells Through Interleukin 1 Receptor Antagonist. Research Square.
+ Open protocol
+ Expand
6

Quantitative Analysis of Lipogenic Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from mouse liver using the Direct-zol RNA MicroPrep Kits (Zymo Research). RNA purity and concentration was determined using a nanodrop. cDNA was made using qScript cDNA SuperMix (Quantabio) and subjected to real-time polymerase chain reaction (RT-PCR) amplification with gene-specific primer using PerfeCTa qPCR FastMix II (Quantabio). The following primers were used for Taqman gene expression assay (Thermo Fisher Scientific): fatty acid synthase (FASN, #Mm00662319_m1); sterol regulatory element binding transcription factor 1-C (SREBP1-C, #Mm00550338_m1); acetyl-CoA carboxylase (ACC1, #Mm01304258_m1), stearoyl-CoA desaturase 1 (SCD1, #Mm00772290_m1), phosphatidate phosphatase (LPIN3, #Mm00499095_m1). Relative abundance of mRNA was normalized to endogenous control 18S.
Scheidemantle G., Duan L., Lodge M., Cummings M.J., Hilovsky D., Pham E., Wang X., Kennedy A, & Liu X. (2023). Data-dependent and -independent acquisition lipidomics analysis reveals the tissue-dependent effect of metformin on lipid metabolism. Research Square.
+ Open protocol
+ Expand
7

Quantitative Analysis of SULT2B1 Expression

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated using TRIzol Reagent (Thermo Fisher) according to the manufacturer's protocol. cDNA was synthesized with M-MuLV Reverse Transcriptase (New England Biolabs, Ipswich, MA) as described previously.18 (link) Quantitative real-time polymerase chain reaction (qRT-PCR) was conducted on LightCycler 96 (Roche, Basel, Switzerland) using PerfeCTa qPCR FastMix II (Quantabio, Beverly, MA) according to the manufacturer's protocol. PrimeTime qPCR Assay probes specific for human SULT2B1b (Hs.PT.58.22508626) or for mouse Sult2b1 (Mm.PT.58.5982373) (Integrated DNA Technologies, Skokie, IL) were used and the transcript levels were normalized using TaqMan Ribosomal RNA Control Reagents (Thermo Fisher).
Yang J., Broman M.M., Cooper P.O., Lanman N.A., Strand D.W., Morrissey C, & Ratliff T.L. (2019). Distinct expression patterns of SULT2B1b in human prostate epithelium. The Prostate, 79(11), 1256-1266.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!