Octadecene

The synthesis of CsPbBr₃ QDs is according to the previously reported hot-injection method with minor modifications^{25 (link)}. Octadecene (4 ml, Sigma-Aldrich, 90%) and PbBr₂ (69 mg, Aladdin, 99.999%) were mixed in a 50 ml four-neck flask and dried under N₂ for 50 min at 120 °C. Then, oleylamine (1 ml, Aladdin, 80–90%) and oleic acid (0.5 ml, Aladdin, >90%) were injected into the flask; after 20 min at 120 °C under N₂, the temperature was raised to 170–190 °C (for tuning the nanocrystals size), hot Cs-oleate (0.4 ml, 0.1 M in ODE, prepared above) was rapidly injected, and 5 s later, the reaction mixture was cooled in the ice-water bath. The resulting NCs were dispersed into toluene for self-assembly.

The nanocrystals were synthesized by thermal decomposition method in boiling oleic acid and octadecene acting as solvents^{51 (link),61 (link)}.
Neodymium(III) acetate hydrate ((CH₃CO₂)₃Nd·3H₂O with 99.9% purity), yttrium(III) acetate hydrate ((CH₃CO₂)₃Y·3H₂O with 99.9% purity), gadolinium(III) acetate hydrate ((CH₃CO₂)₃Gd·3H₂O with 99.9% purity), ammonium fluoride (NH₄F of 98% purity), acetic acid (CH₃CO₂H of 99% purity), oleic acid (CH₃(CH₂)₇CH=CH(CH₂)₇COOH of 90% purity) and 1-octadecene (CH₃(CH₂)₁₅CH=CH₂ with 90% purity) were purchased from Sigma Aldrich. Sodium hydroxide (NaOH with 99.8% purity), ethanol (C₂H₅OH, 96% pure p.a.), methanol (CH₃OH, 99.8%), n-hexane (C₆H₁₄, pure p.a.) and chloroform (CHCl₃, 98.5%) were purchased from POCH S.A. (Poland). Lithium hydroxide (LiOH anhydrous with 99% purity) were purchased from Pol-Aura. All of the chemical reagents were used as received without future purification.

Copper (I) chloride (99.99%, STREM), Oleylamine (Oam, 95%, STREM), Oleic acid (OA, 90%, Aldrich), Octadecene (ODE, 90%, Sigma-Aldrich), Copper (I) acetate (ABCR), Copper (II) acetylacetonate (97%, Sigma-Aldrich), TOPO (Strem, 99%), chlorobenzene (anhydrous, 99.8%, Sigma-Aldrich), Sulfur (99.998%, Sigma-Aldrich), 1-dodecanethiol (98%, Sigma Aldrich), Toluene (99.9%, Sigma-Aldrich), Ethanol (Fluka), Hydrazine (Gerling Holz+Co), Acetonitrile (ACN, max. 0.005% H₂O, Merck), Copper (II) sulfide (CuS, 99.5%, STREM), Copper (I) sulfide (Cu₂S, 99.5%, Alfa Aesar), Magnesium-bis(hexamethyldisilazide (Mg(HMDS)₂, 97%, Sigma-Aldrich), Magnesium bis(trifluoromethanesulfonyl)imide (Mg(TFSI)₂, 99.5%, Solvionic), Magnesium chloride (MgCl₂, 99.9%, Alfa Aesar), Tetraglyme (99%, ABCR).

Chlorotrimethylsilane, tetramethylammonium hydroxide pentahydrate (TMAH), cadmium oxide (CdO), octadecene (ODE), zinc oxide (ZnO), trioctylphosphine oxide (TOPO), selenium (Se), (3-aminopropyl)trimethoxysilane (3-APTMS), trioctylphosphine (TOP), hexadecylamine (HDA), sulfur, succinic anhydride, rhodamine 6G, N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride (EDC), N-hydroxysuccinimide (NHS), HAuCl₄·3H₂O, tannic acid, TGA, MPA, l-cysteine, and GSH were purchased from Sigma Aldrich Co. LLC. (Saint Louis, MO, USA). Oleic acid was purchased from Nacalai Tesque Inc. (Kyoto, Japan). Methanol, tri-sodium citrate and potassium hydroxide (KOH), methanol, acetone, and chloroform were purchased from Wako Pure Chemical Ind. Ltd. (Osaka, Japan). An ultrapure Milli-Q Water System was used for sample preparation. The MB and synthetic DNA targets were purchased from FASMAC Co. Ltd. (Atsugi, Kanagawa, Japan). Black hole quencher-2 (BHQ-2) was used as the fluorescence quencher.
MB sequence: 5′-/NH₂/GCGACTTTCAGTTATTATGCCGTTGTATTTGTCGC/BHQ-2/-3′
Full complementary DNA: AAATACAACGGCATAATAACTGAAA
Single nucleotide DNA: AAATACAACGTCATAATAACTGAAA
Noncomplementary DNA: TGAAGCTAACCGGTAAGCGCTATAG
The bold sequence is the stem sequence of the MB.

FA acetate (3.765 mmol, 0.392 g, Aldrich, 99%) was loaded into a 50 mL three-neck flask along with octadecene (ODE, 18 mL) and oleic acid (12 mL, Sigma-Aldrich, 90%). The reaction mixture was degassed three times at room temperature, heated to 100 °C under nitrogen until the reaction was completed and cooled down to room temperature. The obtained solution was stored in a glovebox.