Hygromycin

Manufactured by InvivoGen

Sourced in United States, France

Hygromycin is a lab equipment product that acts as a selective antibiotic. It is used to kill non-transformed cells and select for transformed cells in cell culture applications.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Hygromycin B (122 citations) Hygromycin B Gold (63 citations) Hygromycin-Gold (3 citations) Hygromycin B (ant-hg-1, (2 citations)

142 protocols using hygromycin

Stable Expression of hY1/2/4/5R-eYFP and Δ6Gαqi4myr in COS-7 Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

COS-7 cells stably expressing hY_1/2/4/5R_eYFP fusion protein and the Δ6Gα_qi4myr chimeric Gα-protein were prepared as previously described [27 (link)]. The hY_1/2/4/5R_eYFP cDNA was subcloned into MCS1 of a pVitro2-MCS vector carrying a hygromycin resistance gene; the Δ6Gα_qi4myr cDNA was subcloned into MCS1 of a pVitro2-MCS vector carrying a G418 resistance gene (Invivogen, San Diego, CA).
COS-7 (African Green Monkey kidney) cells stably expressing the hY_1/2/4/5R_eYFP fusion protein and the Δ6Gα_qi4myr chimeric Gα-protein were cultured at 37°C in high glucose Dulbecco’s Modified Eagle Medium (DMEM, Life Technologies, Carlsbad, CA) with glutamine and sodium pyruvate (Life Technologies/Lonza) supplemented with 10% (w/v) FBS (Invitrogen, Carlsbad, CA), 1.5 mg/mL G418-sulfate (Amresco, Solon, OH) and 133 μg/ml hygromycin (Invivogen).

Sliwoski G., Schubert M., Stichel J., Weaver D., Beck-Sickinger A.G, & Meiler J. (2016). Discovery of Small-Molecule Modulators of the Human Y4 Receptor. PLoS ONE, 11(6), e0157146.

+ Open protocol

+ Expand

Cloning SV40 Enhancer and KL Promoters

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

To clone the SV40 enhancer into pNLCoI1[luc2-P2A-NlucP/Hygro] Vector (Promega), the SV40 enhancer was amplified from pGL3 using the following primers using Clontech HiFi according to the manufacturer’s protocol:
The PCR product was isolated and ligated with pNL vector by digestion with BamHI to generate the pNLCoI1-SV40 vector. The KL 1.8 kb promoter was digested from pGL3-KL1800 (King et al., 2012 (link)) with HindIII and XhoI, and subcloned into pNLCoI1-SV40 vector using the same restriction sites to generate pNLCoI1-SV40-KL1800.
To clone the KL 4 kb promoter, the additional 2.2Kb (−1800 to −4000) and the vector were amplified from HEK293 genomic DNA and pNLCoI1-SV40-KL1800, respectively, with the following primers and ClonAmp HiFi polymerase according to the manufacturer’s protocol:
The insert and vector bands (100 ng each) were ligated together using In Fusion kit (Clontech) to generate pNLCoI1-SV40-KL4000. Stable HEK-293 cells expressing 4kb of the KL promoter or the PGK promoter with the coincidence reporter were generated from single clones and selected using Hygromycin (Invivogen, USA) at a concentration of 75μg/ml for two weeks following Hygromycin 25μg/ml for maintenance.

Chen C.D., Zeldich E., Li Y., Yuste A, & Abraham C.R. (2018). Activation of the anti-aging and cognition-enhancing gene Klotho by CRISPR-dCas9 transcriptional effector complex. Journal of molecular neuroscience : MN, 64(2), 175-184.

+ Open protocol

+ Expand

Stable Overexpression of LRRK1 and LRRK2 in HEK293 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Non-transfected HEK293 Flp-in T-REx wild-type cells were seeded into 10 cm dishes at 4.5 × 10⁶ cells/well. Cells were transfected using Polyethylenimine method [48 (link)]. Briefly, 0.5 µg of LRRK1 or LRRK2 plasmids, 4.5 µg of pOG44 Flp-Recombinase Expression Vector (ThermoFisher, #V600520) and 15 µl of 1 mg/ml PEI were added to 1 ml OptiMEM reduced serum media (GIBCO, #31985-062) and vortexed for 20 sec. Solution was then incubated at room temperature for 20 min to allow the formation of DNA-PEI complexes. Transfection mixes were subsequently added to cell culture medium and allowed to incubate at 37°C. Twenty-four hours post transfection, cells were selected for successful transfection using DMEM containing 10% (v/v) fetal bovine serum, 2 mM l-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin supplemented with 15 µg/ml Blasticidin and 100 µg/ml Hygromycin (Invivogen, #ant-hg-5) for 48 h. Cells were then allowed to recover from selection in Hygromycin by incubation in DMEM containing 10% (v/v) fetal bovine serum, 2 mM l-glutamine, 100 U/ml penicillin-streptomycin for 1 week.

Malik A.U., Karapetsas A., Nirujogi R.S., Chatterjee D., Phung T.K., Wightman M., Gourlay R., Morrice N., Mathea S., Knapp S, & Alessi D.R. (2022). PKC isoforms activate LRRK1 kinase by phosphorylating conserved residues (Ser1064, Ser1074 and Thr1075) within the CORB GTPase domain. Biochemical Journal, 479(18), 1941-1965.

+ Open protocol

+ Expand

IFNβ-GFP Reporter Cell Line Generation

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The IFNβ-luciferase reporter plasmid was a kind give of R. Vance ^{34 (link)}. Using Gibson assembly the luciferase reporter gene was swapped with eGFP (from pBABE-H2B described above) to form the IFNβ-GFP cassette. A fragment derived from the pLKO.1-Hygro plasmid (a gift from B. Weinberg, Addgene #24150) that omitted the U6 promoter sequence was combined with the IFNβ-GFP cassette to generate the pLKO.1-Hygro- IFNβ-GFP reporter. A stable MCF10A cell line was derived as described above by viral infection and selection with 100ug/mL hygromycin (Invivogen). Activation of GFP was monitored by microcopy in fixed cells. The threshold used for quantification of GFP positive cells was kept constant throughout all experiments. p-values were calculated using Graphpad using 1-way ANOVA with a Bonferroni correction.

Harding S.M., Benci J.L., Irianto J., Discher D.E., Minn A.J, & Greenberg R.A. (2017). Mitotic progression following DNA damage enables pattern recognition within micronuclei. Nature, 548(7668), 466-470.

+ Open protocol

+ Expand

Lentiviral Transduction and Selection of HSKM Myoblasts

Check if the same lab product or an alternative is used in the 5 most similar protocols

HSKM myoblasts were seeded in six‐well plates (Falcon) in growth medium comprising of DMEM‐F12 (Gibco) with 20% heat‐inactivated FBS (GE), 1% l‐glutamine (Gibco) and 1% penicillin‐streptomycin (Gibco). Cells were then transduced with 0.1‐1 mL of concentrated viral supernatant in the presence of polybrene (Sigma), and incubated for 16‐24 hours. Transduced cells were selected with growth media containing either hygromycin (0.5 mg/mL) for 6‐8 days, puromycin (1 µg/mL) for 3 days, or G418 (2 mg/mL) for 5‐7 days (InvivoGen).

Chua M.J., Yildirim E.D., Tan J.E., Chua Y.B., Low S.C., Ding S.L., Li C., Jiang Z., Teh B.T., Yu K, & Shyh‐Chang N. (2019). Assessment of different strategies for scalable production and proliferation of human myoblasts. Cell Proliferation, 52(3), e12602.

+ Open protocol

+ Expand

Licochalcone A and LM Compound Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Licochalcone A was purchased from Sigma-Aldrich (St. Louis, MO, USA). In-house LM compounds LM-004, LM-006, LM-016, LM-026, and LM-031 were synthesized and characterized by NMR spectrum as described previously [43 (link)–45 (link)]. All compounds were soluble in a cell culture medium up to 100 μM.
Human TBP/Q₇₉-green fluorescent protein (GFP) 293 and SH-SY5Y cells [42 (link)] were maintained in Dulbecco's modified Eagle's medium (DMEM) (for 293 cells) or DMEM-F12 (for SH-SY5Y cells) supplemented with 10% fetal bovine serum (FBS) (Invitrogen, Carlsbad, CA, USA), with 5 μg/mL blasticidin and 100 μg/mL hygromycin (InvivoGen, San Diego, CA, USA) added to the growth medium.

Chen C.M., Chen W.L., Yang S.T., Lin T.H., Yang S.M., Lin W., Chao C.Y., Wu Y.R., Chang K.H, & Lee-Chen G.J. (2020). New Synthetic 3-Benzoyl-5-Hydroxy-2H-Chromen-2-One (LM-031) Inhibits Polyglutamine Aggregation and Promotes Neurite Outgrowth through Enhancement of CREB, NRF2, and Reduction of AMPKα in SCA17 Cell Models. Oxidative Medicine and Cellular Longevity, 2020, 3129497.

+ Open protocol

+ Expand

Cultured T. brucei Procyclic Parasites

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

T. brucei procyclic form SmOx P9 parasites (Poon et al., 2012 (link)) expressing hSpCas9 (Beneke et al., 2017 (link)) were cultured at 27°C in SDM79 containing 10% (v/v) heat-inactivated fetal bovine serum, 5 μg/ml blasticidin (InvivoGen), 2 μg/ml puromycin. Knock-out parasites were cultured in presence of additional 15 μg/ml G418 (geneticin; Santa Cruz Biotechnology, Heidelberg, Germany) and 25 μg/ml hygromycin (InvivoGen, Nunningen, Switzerland). TbYme1 addback cultures were selected and cultured in the presence of 150 μg/ml nourseothricin (Jena Bioscience, Jena, Germany).

Serricchio M, & Bütikofer P. (2021). A Conserved Mitochondrial Chaperone-Protease Complex Involved in Protein Homeostasis. Frontiers in Molecular Biosciences, 8, 767088.

+ Open protocol

+ Expand

Stable Cell Line Generation and Quantitative Proteomics

Check if the same lab product or an alternative is used in the 5 most similar protocols

Flp-In 293 T-REx cells (Invitrogen) were grown in Dulbecco's modified Eagle's medium high glucose with 10% (v/v) fetal bovine serum, 2 mM L-glutamine. Cell lines stably expressing FLAG/HA-tagged RC3H1 protein were generated by co-transfection of pFRT/TO/FLAG/HA constructs with pOG44 (Invitrogen). Cells were selected by adding 15 μg ml⁻¹ blasticidin and 100 μg ml⁻¹ hygromycin (Invivogen). Expression of epitope-tagged proteins was induced by addition of 1 μg ml⁻¹ doxycyclin. The expression of FLAG/HA-tagged RC3H1 protein was assessed by western analysis using mouse anti-HA.11 monoclonal antibody (Covance). For quantitative proteomics, cells were grown in SILAC medium as described before30 (link)45 (link). Briefly, Dulbecco's modified Eagle's medium GlutaMAX lacking arginine and lysine (PAA) supplemented with 10% dialysed fetal bovine serum (Gibco) was used. Amino acids (84 mg l^{−1 13}C₆¹⁵N₄L-arginine plus 146 mg l^{−1 13}C₆¹⁵N₂L-lysine or 84 mg l^{-1 13}C₆-L-arginine plus 146 mg l⁻¹ D4-L-lysine) or the corresponding non-labelled amino acids (Sigma) were added to obtain ‘heavy' ‘medium' or ‘light' cell culture medium, respectively. Labelled amino acids were purchased from Sigma Isotec.

Murakawa Y., Hinz M., Mothes J., Schuetz A., Uhl M., Wyler E., Yasuda T., Mastrobuoni G., Friedel C.C., Dölken L., Kempa S., Schmidt-Supprian M., Blüthgen N., Backofen R., Heinemann U., Wolf J., Scheidereit C, & Landthaler M. (2015). RC3H1 post-transcriptionally regulates A20 mRNA and modulates the activity of the IKK/NF-κB pathway. Nature Communications, 6, 7367.

+ Open protocol

+ Expand

CRISPR-Mediated Atg5 Knockout

Check if the same lab product or an alternative is used in the 5 most similar protocols

The guide RNA for the Atg5 gene inactivation (CACGTTTCCCACTTGCCTAGTGG; reverse frame) was designed by and purchased from ToolGen. N41 cells were transfected with Cas9 and gRNA plasmids (1:5 ratio) using TurboFect (Thermo Scientific). Homogenous Atg5 knockout was achieved by selection using 1 mg/ml hygromycin (InvivoGen, ant-hg-1) at 24 h after transfection, followed by subculture in fresh DMEM.

Park S., Oh T.S., Kim S, & Kim E.K. (2019). Palmitate-induced autophagy liberates monounsaturated fatty acids and increases Agrp expression in hypothalamic cells. Animal Cells and Systems, 23(6), 384-391.

+ Open protocol

+ Expand

Stable PPARγ Reporter Cell Line

Check if the same lab product or an alternative is used in the 5 most similar protocols

Previously published PPARγ reporter construct pJ3-TK-Luc (kind gift from M. Chamaillard, INSERM Lille, France) was used to establishing HT-29-PPARγ reporter cell-lines. pTK-Hygro (Invivogen) was co-transfected with pJ3-TK-Luc using TFX50™ (Promega), according to manufacturer’s recommendations. Stable reporter cell lines for PPARγ were selected using Hygromycin (600 μg/ml, InvivoGen) and validated using rosiglitazone.

Nepelska M., de Wouters T., Jacouton E., Béguet-Crespel F., Lapaque N., Doré J., Arulampalam V, & Blottière H.M. (2017). Commensal gut bacteria modulate phosphorylation-dependent PPARγ transcriptional activity in human intestinal epithelial cells. Scientific Reports, 7, 43199.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!