Gold chloride trihydrate (HAuCl4·3H2O), sodium citrate, sodium borodeuteride (NaBH4) were obtained from Aladdin Biochemical Technology Co. Ltd. (Shanghai, China). Ti3C2 dispersion liquid was obtained from Jiangsu XFNANO Materials Tech, Co. Ltd. (Nanjing, China). Tris (4,4′-dicarboxylic acid-2,2′-bipyridyl) ruthenium (II) dicbloride (Ru(dcbpy)3Cl2) was obtained from Suna Tech Inc. (Suzhou, China). Tris(2-carboxyethyl) phosphine hydrochloride (TCEP) and 6-mercaptohexanol (MCH) were gained from Sigma-Aldrich (St Louis, MO, USA). The purified DNA sequences (Table S1 ) were synthesized by Genscript Bio-technology Co. Ltd. (Nanjing, China).
6 mercaptohexanol
Manufactured by Merck Group
Sourced in United States, China
6-mercaptohexanol is a chemical compound used as a laboratory reagent. It has the chemical formula C6H14OS and a molecular weight of 134.23 g/mol. This substance can be utilized in various analytical and synthetic procedures, but a detailed description of its core function would require more context to present accurately and without bias.
Automatically generated - may contain errors
Lab products found in correlation
Tris 2 carboxyethyl phosphine hydrochloride tcep, by Merck Group (3 mentions)
Milli q purification system, by Merck Group (2 mentions)
Ethanol, by Merck Group (2 mentions)
Dithiothreitol (dtt), by Merck Group (2 mentions)
Sodium l ascorbate, by Merck Group (1 mentions)
Protein assay dye reagent concentrate, by Bio-Rad (1 mentions)
Sodium dodecyl sulfate (sds), by Merck Group (1 mentions)
Acetonitrile, by Merck Group (1 mentions)
Trifluoroacetic acid, by Merck Group (1 mentions)
1 2 dipalmitoyl sn glycero 3 phosphocholine, by Avanti Polar Lipids (1 mentions)
Sinapinic acid, by Merck Group (1 mentions)
1 octadecanethiol, by Merck Group (1 mentions)
3 mercaptopropionic acid, by Merck Group (1 mentions)
1 3 bis 1 2 dioleoyl sn glycero 3 phospho glycerol, by Avanti Polar Lipids (1 mentions)
Aunps, by BBI Solutions (1 mentions)
Milli q water, by Merck Group (1 mentions)
Foetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Adenosine triphosphate (atp), by Merck Group (1 mentions)
Tris 2 carboxyethyl phosphine hydrochloride, by Merck Group (1 mentions)
Dna oligonucleotides, by Sangon (1 mentions)
11 protocols using 6 mercaptohexanol
1
Synthesis and Functionalization of Gold Nanoparticles
2
Biophysical Analysis of Cytochrome c Interactions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cyt c (from equine heart), phosphatidylcholine (eggPC, from egg yolk), 3-Mercaptopropionic acid, 6-Mercaptohexanol, potassium chloride (KCl), sodium l -ascorbate, ethanol, 1-Octadecanethiol (ODT), trifluoroacetic acid (TFA), acetonitrile (ACN), and sinapinic acid were purchased from Sigma (St. Louis, MO). The lipids 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) and 1′,3′-bis[1,2-dioleoyl-sn-glycero-3-phospho]-glycerol (18:1, CL) were obtained from Avanti Polar Lipids (Alabaster, AL). Sodium dodecyl sulfate (SDS) was purchased from Merck (Darmstadt, Germany). Deuterium oxide (D2O, 99.9%) was obtained from Cambridge Isotope Laboratories (Tewksbury, MA). Immobilized pepsin on 6% agarose beads was purchased from Thermo Scientific (Waltham, MA). A protein assay dye reagent concentrate was purchased from Bio-Rad (Hercules, CA). All aqueous solutions were prepared using ultrapure water (18.2 MΩ cm) from a Milli-Q purification system (Millipore, Burlington, MA). A CL binding dye, 10-nonyl acridine orange (NAO), was obtained from Enzo Life Sciences (Farmingdale, NY).
3
Thiol-modified Oligonucleotide Immobilization on Gold
4
Electrochemical Detection of DNA Tetrahedra
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA oligonucleotides were synthesized and purified by Sangon Biotechnology Inc. (Shanghai, China). 6-Mercaptohexanol (MCH), tris(2-carboxyethyl)phosphine hydrochloride (TCEP), adenosine triphosphate (ATP) and hexaammineruthenium(iii ) chloride (RuHex) were purchased from Sigma. Foetal bovine serum (FBS) was purchased from Life Technologies (Gibco). Blood was collected from lab volunteers. All of the other chemicals were of analytical grade and were used without further purification. All of the solutions were prepared with Milli-Q water from a Millipore system.
The buffers employed were as follows: the DNA tetrahedron preparation and immobilization buffer was 10 mM Tris–HCl and 10 mM MgCl2, pH 7.4. The electrodes were washed in 0.2 M PBS. The hybridization reactions were performed in 10 mM Tris–HCl, 0.5 M NaCl, and 1.5 mM MgCl2, pH 7.4. Electrochemical detection for methylene blue (MB) was performed in 20 mM PBS and 0.5 M NaCl, pH 7.4.
The buffers employed were as follows: the DNA tetrahedron preparation and immobilization buffer was 10 mM Tris–HCl and 10 mM MgCl2, pH 7.4. The electrodes were washed in 0.2 M PBS. The hybridization reactions were performed in 10 mM Tris–HCl, 0.5 M NaCl, and 1.5 mM MgCl2, pH 7.4. Electrochemical detection for methylene blue (MB) was performed in 20 mM PBS and 0.5 M NaCl, pH 7.4.
5
DNA Probe Immobilization and Surface Passivation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Each sensing surface was treated with 100 µL of 10 µM solution of thiolated DNA probe (supplied by Integrated DNA Technologies, Inc., USA) in phosphate buffered saline (PBS) solution for 15 min. Following this, each sensing surface was treated with 100 µL of 5% (v/v) 6-mercaptohexanol (97%, supplied by Sigma-Aldrich, USA) in a 50:50 water:ethanol solvent for 30 min.
6
Fluorescent Probe Fabrication Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Citric acid, ethylenediamine, N-Hydroxysuccinimide (NHS), alumina polishing powder, 6-mercaptohexanol (MCH) and Tris(2-carboxyethyl) phosphine (TCEP) were purchased from Sigma-Aldrich (Shanghai, China). 1-(3-Dimethylaminopropyl)− 3-ethylcarbodiimide hydrochloride (EDC) was purchased from Alfa Aesar China Co. Ltd. (Tianjin, China). The related oligonucleotides are shown in Table S1 . The instruments are listed in the Supplementary Material .
7
Multiplex DNA Immobilization Protocol
8
Trypsin-Based Protein Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Trypsin (MW 23.4 kDa), bovine serum albumin (BSA), casein, ethanol, 6-mercaptohexanol (MCH), 2,2′-(ethylenedioxy) diethanethiol (DT) and 10× PBS were purchased from Sigma Aldrich (UK) and used as received. All reagents were of analytical grade and all solutions were prepared using protease-free deionised water.
9
DNA Aptamer Design and Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All DNA oligonucleotides were synthesized and purified by Sangon Biotechnology Co., Ltd. (Shanghai, China). Luteinizing hormone (LH), follicle‐stimulating hormone (FSH), and thyroid stimulating hormone (TSH) were obtained from ANPEL Laboratory Technologies Inc. (Shanghai China). Immune globulin G (IgG) and serum albumin (SAB) were purchased from Sigma‐Aldrich Co., Ltd. (USA). Neutrophil gelatinase‐associated lipocalin (NGAL) and nucleolin (NCL) were obtained from Sino Biological (Beijing, China) and Shanghai kanglang Biotech Co., Ltd, respectively. Tris‐(2‐carboxyethyl) phosphine hydrochloride (TCEP) and 6‐Mercaptohexanol (MCH) were also acquired from Sigma‐Aldrich Co., Ltd. (USA). Human LH ELISA Kit was also purchased from Sangon Biotechnology Co., Ltd. (Shanghai, China). All of the clinical samples were provided by Renji Hospital (Shanghai, China). Rabbit whole blood was obtained from Ruite Biotechnology Co., Ltd. (Guangzhou, China). The PBS buffer involved used was phosphate buffer (10 × 10−3 m , pH 7.4) containing 1 m NaCl. The TM buffer used was Tris buffer (20 × 10−3 m , pH 8.0) containing 50 × 10−3 m MgCl2. Deionized water purified by a Millipore system (18.2 MΩ cm) was used throughout the experiment.The DNA sequence used as follow (5’‐3’)
Aptamer: TATGGTATGCTGTGTGGTATGGGGTGGCGTGCTCT
Signal probe: ACACAGCATACCATA‐MB
Helper probe: SH‐(CH2)6‐TATGGTATGCTGTGT
10
Oligonucleotide-Based Sensor Development
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The oligonucleotides purified by high-performance liquid chromatography (HPLC) used in our detection strategy were purchased from Genscript Biotech (Nanjing, China). Gold chloride trihydrate (HAuCl4·3H2O), sodium citrate, potassium persulfate (K2S2O8), and sodium borohydride (NaBH4) were obtained from Aladdin Biochemical Technology Co. Ltd. (Shanghai, China). g-C3N4 were obtained from Jiangsu XFNANO Materials Tech, Co. Ltd. (Nanjing, China). Tris(2-carboxyethyl) phosphine hydrochloride (TCEP) and 6-mercaptohexanol (MCH) were gained from Sigma-Aldrich (St Louis, MO, USA). Exonuclease III and 10 × NEB buffer were obtained from New England Biolabs (USA). The purified DNA fragments (Table S1 ) were synthesized by Genscript Biotechnology Co. Ltd. (Nanjing, China)
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!