Abi 7300 thermal cycler
The ABI 7300 thermal cycler is a laboratory instrument used for the amplification of DNA samples through the polymerase chain reaction (PCR) process. It precisely controls the temperature and timing of the thermal cycling steps required for DNA replication. The ABI 7300 features a 96-well sample block and supports real-time PCR detection. It is designed to provide accurate and reliable performance for a variety of PCR applications.
Lab products found in correlation
20 protocols using abi 7300 thermal cycler
Gene Expression Analysis of Liver and Pancreatic Tissues
Quantitative and Microarray Gene Expression Analysis
For the Illumina (San Diego, CA) Micro‐array Gene Expression experiment, total RNA was extracted from A549 and H1299 cells as described above. Samples from three independent transfection experiments along with untransfected cells were used for analysis. Gene expression analysis was performed using the HumanHT12 (48,000 probes, RefSeq plus EST) array. Data was analyzed using Genome Studio software (Illumina). Only changes of ±2‐fold or more in gene expression common to the two cell lines were taken into consideration. These changes were confirmed using Q‐PCR.
Quantitative RT-PCR Analysis of MIN6 and Murine Islet
Quantitative real-time PCR analysis
Quantitative Real-Time PCR Analysis of Lung Gene Expression
Target | Forward primer sequence | Reverse primer sequence |
---|---|---|
CCL11 | TGTAGCTCTTCAGTAGTGTGTTG | CTTCTATTCCTGCTGCTCACG |
GAPDH | GTGGAGTCATACTGGAACATGTAG | AATGGTGAAGGTCGGTGTG |
IL-33 | AATCACGGCAGAATCATCGAGAAA | GGAGCCAGAGGATCTCCGATT |
IL-13 | CCAGGGCTACACAGAACCCG | GCTCTTGCTTGCCTTGGTGG |
IL-5 | ACTGTCCGTGGGGGTACTGT | CCTCGCACACTTCTCTTTTTGG |
HPV Subtype Detection Protocol
Isolation and Analysis of Lung RNA
Quantitative gene expression analysis
Isolation and Analysis of Lung RNA
RT-qPCR Analysis of ITGB1 and FAK Genes
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!