HEK293T-GFPΔ35, U2OS-GFPΔ35 and C6 were seeded onto 96-well plates at a density of 2 × 105 cells per well in serum-containing medium with 200 ng/ml of nocodazole (Sigma-Aldrich). After 30 min, the AAV donor vector (t37EGFP-AAV1 for HEK293T-GFPΔ35 and U2OS-GFPΔ35, and nestin-AAV1 for C6) was added onto cells in the presence of 200 ng/ml of nocodazole. After 16 h, cells were dissociated with 0.05% trypsin (Thermo-Fisher), centrifuged at 400 × g for 3 min, washed once with PBS and resuspended in 20 μl of Nucleofector Solution SF (Lonza) with 10 μl of RNP. Cells were nucleofected using the Amaxa 96-well Shuttle system (Lonza) and the program CM120. Immediately after nucleofection, 100 μl of serum-containing medium was added to nucleofected wells, and cells were transferred into a fresh 96-well plate until further use. HEK293T-GFPΔ35 and U2OS-GFPΔ35 were maintained in serum-containing medium, and C6 cells were maintained in serum-containing medium with 50 ng/ml of FGF-2.
Nucleofector solution sf
Manufactured by Lonza
Sourced in United States
The Nucleofector Solution SF is a specialized electroporation buffer designed for the transfection of hard-to-transfect cell types. It facilitates the transfer of genetic material, such as plasmids or small interfering RNAs, into the nuclei of cells using an electrical pulse. The solution is optimized to maintain cell viability and support the efficient delivery of the desired genetic material.
Automatically generated - may contain errors
Lab products found in correlation
Amaxa 4d nucleofector x unit, by Lonza (4 mentions)
Megascript t7 kit, by Thermo Fisher Scientific (3 mentions)
4d nucleofector apparatus, by Lonza (2 mentions)
Mlui hf, by New England Biolabs (2 mentions)
Envision plate reader, by PerkinElmer (2 mentions)
Passive lysis buffer (plb), by Promega (2 mentions)
Luciferase assay system, by Promega (2 mentions)
Nocodazole, by Merck Group (1 mentions)
Trypsin, by Thermo Fisher Scientific (1 mentions)
Amaxa 96 well shuttle system, by Lonza (1 mentions)
Amaxa 4d nucleofector system, by Lonza (1 mentions)
Amaxa 4d nucleofector, by Lonza (1 mentions)
Sf cell line 4d nucleofector x kit s, by Lonza (1 mentions)
Gene knockout kits v2, by Synthego (1 mentions)
Spyfi cas9, by Aldevron (1 mentions)
Spectramax i3x multi mode microplate reader, by Molecular Devices (1 mentions)
M7g 5 ppp 5 g rna cap structure analog, by New England Biolabs (1 mentions)
Renilla luciferase assay system, by Promega (1 mentions)
Truecut v2, by Thermo Fisher Scientific (1 mentions)
Geneart precision grna synthesis kit, by Thermo Fisher Scientific (1 mentions)
10 protocols using nucleofector solution sf
1
Optimized CRISPR-AAV Transduction Protocols
2
Transient Transfection of Hematopoietic Cell Lines
3
DNA Electroporation for Cell Transfection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA delivery was carried out on a 20-μL volume format using an Amaxa 4D-Nucleofector system and cell line Nucleofector solution SF (Lonza). The total amount of DNA electroporated was 3 μg (1.5 μg for each plasmid in the case of using two plasmids at the same time). 2 × 105 cells were electroporated following the manufacturer’s protocol under the FF-120 program.
4
CRISPR-Cas9 Transfection of iPSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For electroporation, 4 × 105 PCD_02:30 iPSC were transfected with 52 pmol Cas9 protein and 60 pmol premixed Alt-R CRISPR-Cas9 tracrRNA and Alt-R CRISPR-Cas9 crRNA (IDT DNA Technologies) in Nucleofector Solution SF (Lonza) in a final volume of 25 μl. Cells were transfected with the Amaxa 4D-Nucleofector (Lonza) device using program CA-137 and then resuspended in with E8 medium supplemented with 10 μM Y-27632 for 24 h.
5
HEK293 Cell Electroporation for DNA Delivery
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNAs were delivered to HEK293 cells by electroporation with a 4D-Nucleofector apparatus (Lonza) as per the manufacturer’s recommendations. Cells were seeded in standard culture flasks 48 h prior to electroporation and harvested by incubation with trypsin-EDTA when 80–90% confluent. Approximately 2.0E+6 cells were added to complete medium and pelleted at 90 g for 10 minutes at room temperature. DNA pellets were thawed, dissolved in 10 μl of sterile water and brought to 100 μl in freshly supplemented Nucleofector solution SF (Lonza). Each cell pellet was gently resuspended in the DNA solution and transferred to a Nanocuvette (Lonza). The mixture of cells and DNA was subjected to the preprogrammed pulse CM130. Cells were transferred to pre-warmed medium in a T25 flask immediately following electroporation.
6
Pooled Knockout Cell Line Generation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pooled knockout cell lines were generated by electroporating Cas9-guide RNA ribonucleoprotein (RNP) complexes into reporter K562 cells using an Amaxa 4D Nucleofector X Unit (Lonza) and the SF Cell Line 4D-Nucleofector X Kit S (Lonza). Gene Knockout Kits v2 (Synthego) composed of three unique guide RNAs per target were ordered for each gene of interest. Guide RNAs were resuspended in 10 mM Tris, 1 mM EDTA pH 8.0 to a final concentration of 100 µM. Cas9 RNPs were generated by incubating 0.6 µl SpyFi Cas9 (Aldevron) and 1 µl (3.2 µg) guide RNA per gene target at room temperature for 10 min before electroporation. 2 × 105 cells were resuspended in 20 µl Nucleofector Solution SF (Lonza), combined with the assembled Cas9 RNPs, and the cells were electroporated in a 16-well cuvette using program FF-120.
Variable guide RNA sequences included in the Synthego Gene Knockout Kits for RNF185, RNF5, and UBE2D3 were: CAGCCAAGGAUGGCAAGCAA (RNF185 #1), AAUGGCGCUGGCGAGAGCGG (RNF185 #2), CAGGCUGAUGACGGCAUCCU (RNF185 #3), GUCUCUCACCUGGGAUCCUG (RNF5 #1), UCUUCCACACCGUUUUCCAA (RNF5 #2), GGCUGGAGACACGGCCAGAA (RNF5 #3), UAGAGCAUUCUUGGAAGAUA (UBE2D3 #1), UGAGGGAAAAUACUUGCCUU (UBE2D3 #2), and CAGAAUGACAGCCCAUAUCA (UBE2D3 #3). A synthetic sgRNA against the AAVS1 safe-harbor locus served as a control guide (guide sequence: GGGGCCACUAGGGACAGGAU [Amrani et al., 2018 (link)]).
Variable guide RNA sequences included in the Synthego Gene Knockout Kits for RNF185, RNF5, and UBE2D3 were: CAGCCAAGGAUGGCAAGCAA (RNF185 #1), AAUGGCGCUGGCGAGAGCGG (RNF185 #2), CAGGCUGAUGACGGCAUCCU (RNF185 #3), GUCUCUCACCUGGGAUCCUG (RNF5 #1), UCUUCCACACCGUUUUCCAA (RNF5 #2), GGCUGGAGACACGGCCAGAA (RNF5 #3), UAGAGCAUUCUUGGAAGAUA (UBE2D3 #1), UGAGGGAAAAUACUUGCCUU (UBE2D3 #2), and CAGAAUGACAGCCCAUAUCA (UBE2D3 #3). A synthetic sgRNA against the AAVS1 safe-harbor locus served as a control guide (guide sequence: GGGGCCACUAGGGACAGGAU [Amrani et al., 2018 (link)]).
7
DENV Replicon RNA Electroporation Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DENV replicon plasmid (Marceau et al., 2016 (link)) was linearized using XbaI restriction enzyme. Replicon RNA was generated using the MEGAscript T7 Kit (Invitrogen) with the reaction containing 5mM m7G(5')ppp(5')G RNA Cap Structure Analog (New England BioLabs). Resulting RNA was purified by lithium chloride precipitation. For electroporation, 2 million WT or EMC4 KO HEK293FT cells were washed twice in PBS, resuspended in 100 μl SF Nucleofector solution (Lonza), mixed with 4 μg replicon RNA, transferred to a 100 ul nucleocuvette and pulsed using program CM-130 on an Amaxa 4D-Nucleofector X Unit (Lonza). Cells were then resuspended in antibiotic-free medium, distributed into 96-wells and lysed at different timepoints post-electroporation using Renilla Lysis buffer. Luminescence was measured using Renilla Luciferase Assay system (Promega) on a Spectramax i3x Multi-Mode Microplate Reader (Molecular Devices).
8
Replicon Plasmids and Electroporation
9
CRISPR/Cas9-mediated SOX10 gene editing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A pair of gRNA oligonucleotides (Eurofins and GeneArt Precision gRNA synthesis kit, Thermo Fisher Scientific) was designed (Benchling) to target the coding sequence in exon 4 of SOX10. CRISPR/Cas9 scrambled gRNAs was used as control. Cas9 protein (TrueCut V2 Thermo Fisher Scientific, 1.25 mg per sample) was incubated with 120 ng of the upstream and downstream flanking gRNA in a 10 mL final volume of Cas9 reaction buffer (100 mM NaCl, 5 mM MgCl2, 20 mM HEPES, 0.1 mM EDTA, pH 6.5 at 25°C) for 10 minutes at RT. This 10 mL of CRISPR/Cas9 complex was then added to 105 cells suspended in 20 mL of the SF Nucleofector Solution (Lonza). The cell solution was transferred to 16-well Nucleovette strips (Lonza) and nucleofected in the 4D Nucleofector System (Lonza) using the CM-137 Nucleofector program. Finally, electroporated cells were transferred to a 24-well plate with preheated cell culture media and incubated for 48 hours before monoclonal selection. CRISPR/Cas9-edited cells were verified with Sanger sequencing (Eurofins/GATC) and at protein level by Western blot.
10
Replicon Plasmids and Electroporation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The replicon plasmids pLuc-HAV/18f and pLuc-HAV/18f-3DpolGDD→GAA (replication-defective mutant) were kindly provided by Stanley Lemon and were described previously (González-López et al., 2018 ). Plasmids were linearized using MluI-HF (New England BioLabs), RNA was generated using the MEGAscript T7 Kit (Invitrogen) and subsequently purified by lithium chloride precipitation. For electroporation, 1-2 million cells were washed three times in PBS, resuspended in 100 μL SF Nucleofector solution (Lonza), mixed with 250 ng replicon RNA per 80k cells, transferred to a 100 μL nucleocuvette and pulsed using the program FF-137 on an Amaxa 4D-Nucleofector X Unit (Lonza). Cells were then resuspended in equilibrated, antibiotic-free medium, distributed into 96-wells and lysed at different time points post-electroporation using 40 μL Passive Lysis buffer (Promega). Luminescence was measured using Luciferase Assay System (Promega) on a white-walled luminescence plate with an EnVision plate reader (PerkinElmer).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!