Fast start dna master sybr green 1 real time pcr kit

RNA was purified using RNeasy kits (Qiagen, Les Ulis, France). The concentration of RNA was quantified by spectrophotometry (SmartSpec™ 3000, Biorad, Hercules, CA, USA). Total RNA (500 ng) was reverse transcribed with the QuantiTec Reverse Transcription (Qiagen Kit) into cDNA. PCR amplification was performed on a LightCycler (Roche Diagnostics, Switzerland) using Fast-Start™ DNA Master SYBR Green I real-time PCR kit (Roche Molecular Biochemicals, Switzerland). The expression of the genes was normalized to the expression of human cyclophilin B (CPB) (5′tgtggtgtttggcaaagttc3′; 3′gtttatcccggctgtctgtc5′) (Qiagen). The list of primers (Qiagen) is as follows: BMP2 (5′ccaccatgaagaatctttgga3′; 3′gagttggctgttgcaggttt5′), RUNX2 (5′gtggacgaggcaagagttt3′; 3′tggggtctgtaatctgactc5′), Wnt5a (5′attcttggtggtcgctaggt3′; 3′accttcgatgtcggaattgat5′).

RNA was purified using RNeasy kits (Qiagen, Les Ulis, France). The concentration of RNA was quantified by spectrophotometry (SmartSpec™ 3000, Biorad, Hercules, CA, USA). Five hundred nanograms of total RNA was reverse transcribed with the Quanti Tec Reverse Transcription (Qiagen Kit) into cDNA. PCR amplification was performed on a Light Cycler (Roche Diagnostics, Switzerland) using Fast-Start™ DNA Master SYBR Green I real-time PCR kit (Roche Molecular Biochemicals, Switzerland). The expression of the genes was normalized to the expression of human cyclophilin B (CPB) (Qiagen; 5′tgtggtgtttggcaaagttc3′; 3′gtttatcccggctgtctgtc5′). The list of primers (Qiagen) is as follows: BMP2 (5′ccaccatgaagaatctttgga3′; 3′gagttggctgttgcaggttt5′), RUNX2 (5′gtggacgaggcaagagttt3′; 3′tggggtctgtaatctgactc5′), DKK-1 (5′ccttggatgggtattccaga3′; 3′tccatgagagccttttctcc5′), RANKL (5′accagcatcaaaatcccagg3′; 3′ccccaaagtatgttgcatcc5′), Shn 3 (5′ccctg agccataaccctgaa 3′; 3′gtaggacttggcgttggtgt 5′), TNF-α receptor type II (TNFRII) (5′ ggtctccttgctgctgtttc3′; 3′ccggagattctcaaatccaa5′), and TNF-α receptor type I (TNFRI) (5′ accaagtgccacaaaggaac 3′; 3′ctgcaattgaagcactggaa 5′).