Pires vector

Manufactured by Takara Bio

Sourced in United States

The PIRES vector is a plasmid designed for gene expression in mammalian cells. It contains a CMV promoter to drive high-level recombinant protein expression and a puromycin resistance gene for selection of stable transfectants.

Automatically generated - may contain errors

Lab products found in correlation

In fusion hd cloning kit, by Takara Bio (1 mentions) Primestar max dna polymerase, by Takara Bio (1 mentions) In fusion technology, by Takara Bio (1 mentions) Pcdna3.1 eukaryotic expression vector, by Thermo Fisher Scientific (1 mentions) Facscalibur flow cytometer, by BD (1 mentions) Gene pulser apparatus, by Bio-Rad (1 mentions) Vent dna polymerase, by New England Biolabs (1 mentions) Jetprime dna and sirna transfection reagent, by Polyplus Transfection (1 mentions) Luc2 gene, by Promega (1 mentions) In fusion snap assembly master mix, by Takara Bio (1 mentions)

Spelling variants of this product

PIRES (21 citations) PIRES‐neo vector (9 citations) PIRES-hyg3 vector (6 citations) PIRES-EGFP vector (5 citations) PIRES expression vector (2 citations) PIRES- ZsGreen1 vector (2 citations)

10 protocols using pires vector

Constructing TIRAP-2A-sRAGE Fusion Protein

Check if the same lab product or an alternative is used in the 5 most similar protocols

Flag-TIRAP was PCR amplified from pCMV2-flag-TIRAP (a gift from Ruslan Medzhitov, Howard Hughes Medical Institute, Chevy Chase, MD). The amplified Flag-TIRAP was cloned into the MSCV-IRES-GFP (MIG) retroviral vector (plasmid 20672; Addgene). To clone the TIRAP-2A-sRAGE construct, Flag-TIRAP was cloned into the pIRES vector (631605; Clontech). The IRES sequence in the pIRES vector was replaced with the E2A sequence encoding a self-cleaving peptide that was PCR amplified from pWpT-E2A-EGFP (Martinez-Høyer et al., 2020 (link)). The E2A sequence was followed by soluble RAGE, which was PCR amplified from the pcDNA3.1-RAGE construct (plasmid 71435; Addgene) using primers designed against the extracellular domain of RAGE protein. The final TIRAP-2A-sRAGE was then cloned in front of the IRES-GFP sequence in the MIG retroviral vector.
Virus packaging and infection of ecotropic packaging cell lines (GP⁺E86) was performed as previously described (Starczynowski et al., 2010 (link)) to obtain stable MIG-TIRAP and MIG-TIRAP-2A-sRAGE lines. Sequencing information confirmed the expression of human TIRAP isoform b in the MIG-TIRAP and the extracellular domain of RAGE in MIG-TIRAP-2A-sRAGE constructs and cell lines.

Gopal A., Ibrahim R., Fuller M., Umlandt P., Parker J., Tran J., Chang L., Wegrzyn-Woltosz J., Lam J., Li J., Lu M, & Karsan A. (2022). TIRAP drives myelosuppression through an Ifnγ–Hmgb1 axis that disrupts the endothelial niche in mice. The Journal of Experimental Medicine, 219(3), e20200731.

+ Open protocol

+ Expand

Molecular Cloning and Characterization of Tha-Virus Proteins

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

All the sequences were amplified by reverse transcription-polymerase chain reaction (RT-PCR) on RNA extracted from Tha-virus–infected HeLa cells using specific primers. PCR products were inserted into the vector of interest using In-Fusion^TM HD Cloning Kit (Clontech).
Viral P and M sequences were cloned, respectively, with C-terminal and N-terminal FLAG-tags into the pIRES vector (Clontech, PT3266-5) using NheI and XhoI restriction sites. The complete Tha-virus genome was inserted into pSDI-Flash-HH-SC^{37 (link)}, as previously described^{22 (link)}. Plasmids for the protein-complementation assays (PCA) were obtained by cloning M, P, Stat1 and Jak1 sequences into vectors containing the N-terminal (pCMV-KDEL-Glu1) or C-terminal part (pCMV-KDEL-Glu2) of Gaussia luciferase, respectively, using BstXI/SalI and XhoI/SacII restriction sites^{38 (link)}. To study the impact of a third protein in PCAs, plasmids coding for M, P, STAT1 or JAK1 protein without FLAG- or HA-tag were used.
Mutations were introduced into the Tha-genome or P- and/or M-protein plasmids using Change-IT^TM Multiple Mutation Site-Directed Mutagenesis Kit (Afflymetrix) and specific primers, as described previously^{22 (link)}.

Sonthonnax F., Besson B., Bonnaud E., Jouvion G., Merino D., Larrous F, & Bourhy H. (2019). Lyssavirus matrix protein cooperates with phosphoprotein to modulate the Jak-Stat pathway. Scientific Reports, 9, 12171.

+ Open protocol

+ Expand

Bicistronic Plasmid Construction for GST Pull-down

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the GST pull-down assay, a bicistronic expression plasmid (pIRES-SHP_1-257-PYD_3-97-STrEP-C_term) was constructed for simultaneous translation of SHP and PYD genes from the same mRNA transcript. The gene encoding SHP_1-257 was amplified by polymerase chain reaction (PCR) using primers carrying NheI and XhoI restriction enzyme sites at their 5′ and 3′ ends, respectively: forward, 5′- CATAGCTAGCATGGGCAGCACCAGCCAAC -3′; and reverse, 5′- CCGCTCGAGTCACCTGA GCAAAAGCATG -3′. The resulting PCR product was cloned into multiple cloning site A of the pIRES vector (Clontech Laboratories Inc.). For generation of a C-terminal Strep-tagged PYD construct, the gene encoding PYD_3-97 was intermediately cloned into the pEXPR-IBA103 vector (IBA) using primers carrying XbaI and XhoI restriction enzyme sites: forward, 5′- GCTCTAGAATGGCAAGCACCCGCTGC -3′; and reverse, 5′- CCGCTCGAGAT CTGAACCCCACTTC -3′. It was later sub-cloned into multiple cloning site B of the pIRES vector using the restriction enzymes XbaI and NotI.

Yang C.S., Kim J.J., Kim T.S., Lee P.Y., Kim S.Y., Lee H.M., Shin D.M., Nguyen L.T., Lee M.S., Jin H.S., Kim K.K., Lee C.H., Kim M.H., Park S.G., Kim J.M., Choi H.S, & Jo E.K. (2015). Small heterodimer partner interacts with NLRP3 and negatively regulates activation of the NLRP3 inflammasome. Nature Communications, 6, 6115.

+ Open protocol

+ Expand

Synthesis and characterization of DDI2 and Nrf1 cDNAs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human DDI2 cDNA was synthesized from total RNA extracted from HT1080 cells using the indicated primers. Forward: 5’-ATGCTGCTCACCGTGTACTGTGTGC-3’, Reverse: 5’-TCATGGCTTCTGACGCTCTGCATCC-3’. DDI2 UBL deletion mutant was synthesized using 5’-AACTTACCCCGAATAGATTTCAG-3’ for a forward primer. siRNA resistant mutations were introduced without changing amino acid sequence using the following primers. Forward: 5’- TAATGTTGTATATTAACTGCAAAGTGAATGGACATCCTG-3’, Reverse: 5’- CGACCTGTCCAAAACTTTCCGGAGCCTCTTCCATAGC-3’. Human Nrf1 cDNA was synthesized from total RNA extracted from HEK293A cells using the indicated primers. Forward: 5’-ATGCTTTCTCTGAAGAAATACTTAACG-3’, Reverse: 5’-TCACTTTCTCCGGTCCTTTGG-3’. PCR was performed using PrimeSTAR Max DNA polymerase (Takara Bio, Shiga, Japan). Amplified fragments were subcloned into pIRES vector (Clontech Laboratories, Mountain View, CA) and all constructs were confirmed by sequencing.

Koizumi S., Irie T., Hirayama S., Sakurai Y., Yashiroda H., Naguro I., Ichijo H., Hamazaki J, & Murata S. (2016). The aspartyl protease DDI2 activates Nrf1 to compensate for proteasome dysfunction. eLife, 5, e18357.

+ Open protocol

+ Expand

Bicistronic Expression of Lifeact-GFP and NLS-mCherry

Check if the same lab product or an alternative is used in the 5 most similar protocols

For simultaneous expression of Lifeact-GFP and NLS-mCherry, we created a bicistronic expression vector consisting of Lifeact-GFP, an IRES sequence (derived from a pIRES vector; Clontech), and NLS-mCherry (Fig. 1 a). This construct was built using InFusion technology (Clontech) and was cloned in a pcDNA3.1(+) eukaryotic expression vector (Invitrogen).

Fusco L., Lefort R., Smith K., Benmansour F., Gonzalez G., Barillari C., Rinn B., Fleuret F., Fua P, & Pertz O. (2016). Computer vision profiling of neurite outgrowth dynamics reveals spatiotemporal modularity of Rho GTPase signaling. The Journal of Cell Biology, 212(1), 91-111.

+ Open protocol

+ Expand

Generation of a Membrane-bound TNFα Mutant

Check if the same lab product or an alternative is used in the 5 most similar protocols

A membrane-bound TNFα (mTNFα) mutant resistant to TACE mediated cleavage, with amino acids 77 through 88 removed, was generated by site-directed mutagenesis as described previously [16 (link)]. The mTNFα DNA sequence was cloned into the pIRES vector (Clontech Laboratories, Inc.). The pIRES vector contained the CMV IE promoter driving expression of the mTNFα gene and a neomycin resistance marker for stable selection in mammalian cells. The transient transfected mTNFα cell line was created by transfection of mTNFα/pIRES in Jurkat T cells (ATCC, TIB-152) using Gene Pulser apparatus (Bio-Rad Laboratories, Hercules, CA). Two days after transfection, the cells were used in apoptosis assay. The stable mTNFα cell line was created by transfection of mTNFα/pIRES in CHO-K1 cells (ATCC, CCL-61). The transfected cells were selected by 500 μg/ml G418. Single-cell clones with high mTNFα expression were screened by a FACSCalibur flow cytometer (Becton Dickinson).

Shen Y., Li G., Gu C., Chen B., Chen A., Li H., Gao B., Liang C., Wu J., Yang T., Jin L, & Su Y. (2017). T0001, a variant of TNFR2-Fc fusion protein, exhibits improved Fc effector functions through increased binding to membrane-bound TNFα. PLoS ONE, 12(5), e0177891.

+ Open protocol

+ Expand

Efficient Survivin Vector Construction

Check if the same lab product or an alternative is used in the 5 most similar protocols

An efficient survivin vector was constructed based on the previous method27 (link). Briefly, the total mRNA from A2780 cells was used as templates. The forward and reverse primers targeting survivin were 5′-CTTCGAATTCGCCACCATGGGTGCCCCGACGTTGCCCCCTGCCTGG-3′, and 5′-GGGCGGATCCTCAATCCATGGCAGCCAGCTGCTCGATGG-3′, respectively. The purified RT-PCR product was inserted into the pIRES-vector (Clontech, CA, USA) to form the pIRES-survivin plasmid. Using the TurboFect transfection reagent (Thermo Scientific), A2780 cells (2 × 10⁵) were transfected with 3 μg pIRES-vector or pIRES-survivin, followed by incubation with 48 h for subsequent experiments.

Xu Y., Wang S., Chan H.F., Lu H., Lin Z., He C, & Chen M. (2017). Dihydromyricetin Induces Apoptosis and Reverses Drug Resistance in Ovarian Cancer Cells by p53-mediated Downregulation of Survivin. Scientific Reports, 7, 46060.

+ Open protocol

+ Expand

Cloning and Sequencing of codon-optimized LtrA

Check if the same lab product or an alternative is used in the 5 most similar protocols

The human codon optimized LtrA sequence was generated from overlapping oligonucledotides by assembly PCR [65 (link)]. Oligonucleotides containing hLtrA sequence were synthesized by HHMI/Keck Oligonucleotide Synthesis Facility (Yale) and PCR reactions were carried out by using Vent DNA polymerase (New England Biolabs), high annealing temperatures (58–60°C), and manual hot start–i.e., adding Vent DNA polymerase after sample temperature reached 94°C). PCR products were gel-purified and digested with EcoRI and XbaI or HindIII and XbaI, then cloned into pKSBluescript (Agilent) to form pKS-hLtrA and confirmed by sequencing. The assembled ORF was re-cloned into a pIRES vector (Clontech) to generate phLtrA1.

Truong D.M., Hewitt F.C., Hanson J.H., Cui X, & Lambowitz A.M. (2015). Retrohoming of a Mobile Group II Intron in Human Cells Suggests How Eukaryotes Limit Group II Intron Proliferation. PLoS Genetics, 11(8), e1005422.

+ Open protocol

+ Expand

Ectopic Expression of Lmo2, Myb, and Nfe2

Check if the same lab product or an alternative is used in the 5 most similar protocols

Full length construct of mouse Lmo2 (MMM1013-202769386), Myb (MMM1013-202763262) and Nfe2 cDNAs (MMM1013-202804796) were purchased from Dharmacon (GE Healthcare Dharmacon, Milwaukee, WI, USA). Each protein coding portion is cloned into the pIRES vector (Takara Bio USA, Mountain View, CA, USA, PT3266-5) using suitable restriction sites. The resultant expression vectors were transduced into 4T1.0 clone using JetPRIME DNA and siRNA transfection reagent (Polyplus transfection, Illkirch, France). Then, the cells were cultured in medium containing G418 (400 µg/mL) for 7 days, to obtain constitutively expressing clones.

Zhang D., Iwabuchi S., Baba T., Hashimoto S.I., Mukaida N, & Sasaki S.I. (2020). Involvement of a Transcription factor, Nfe2, in Breast Cancer Metastasis to Bone. Cancers, 12(10), 3003.

+ Open protocol

+ Expand

Construction of SARS-CoV-2 Subreplicon RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

To construct the SARS-CoV-2 subreplicon RNA expression vector, 5′-UTR (1–265), a part of ORF1a (266–475), nucleocapsid (N, 28277–29530), and ORF10 and 3′-UTR (29531–29870) were selected from the SARS-CoV-2 genome sequence (GenBank: MN994467), and the firefly luciferase sequence (luc2 gene, Promega, Madison, WI, USA) was inserted between ORF1a and the nucleocapsid.
DNA fragments containing 5′-UTR, ORF1a, nucleocapsid, ORF10, and 3′-UTR of the SARS-CoV-2 genome sequence and the luc2 gene (Promega) were synthesized in vitro using an artificial gene synthesis service (FASMAC, Atsugi, Japan) (Figure 1). The fragment was amplified using 5′-TCACATGGCTCGACAGATCTATTAAAGGTTTATACCTTCCC-3′ and 5′-CGGATCGATCCTTATCGGATGTCATTCTCCTAAGAAGCTATT-3′. A partial sequence of the pIRES vector (Takara Bio, Kusatsu, Japan) was amplified using 5′-ATCCGATAAGGATCGATCCG-3′ and 5′-AGATCTGTCGAGCCATGTGA-3′. The SARS-CoV-2 subreplicon sequence was fused between the CMV promoter and the f1 ori using the In-Fusion Snap Assembly Master Mix (Takara Bio).

Furutani Y., Toguchi M., Higuchi S., Yanaka K., Gailhouste L., Qin X.Y., Masaki T., Ochi S, & Matsuura T. (2021). Establishment of a Rapid Detection System for ISG20-Dependent SARS-CoV-2 Subreplicon RNA Degradation Induced by Interferon-α. International Journal of Molecular Sciences, 22(21), 11641.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!