Veriquest fast sybr green qpcr kit

A549 cells, transfected with plasmids and infected with RSV where mentioned, were harvested, and intracellular RNA was purified at the designated times posttransfection (BioTake). Viral RNA was isolated from the mixture of cells and medium supernatants. The whole-lung tissues of mice were treated the same way as described earlier. RNA (1 μg) was used for first-strand cDNA synthesis, and the cDNA was amplified using the VeriQuest Fast SYBR green qPCR kit (Invitrogen) with the following primers: Rab5a (forward primer, 5′-CAAGAACGATACCATAGCCTAGCAC-3′; reverse primer, 5′-CTTGCCTCTGAAGTTCTTTAACCC-3′); IFNA1 (forward primer, 5′-GTGAGGAAATACTTCCAAAGAATCAC-3′; reverse primer, 5′-TCTCATGATTTCTGCTCTGACAA-3′); IFNB1 (forward primer, 5′-CAGCAATTTTCAGTGTCAGAAGC-3′; reverse primer, 5′-TCATCCTGTCCTTGAGGCAGT-3′); and IFN-λ (forward primer, 5′-CGCCTTGGAAGAGTCACTCA-3′; reverse primer, 5′-GAAGCCTCAGGTCCCAATTC-3′).
RSV copy numbers were quantified with TaqMan qPCR as previously described (45 (link)). The PCR cycle conditions were as follows: 50°C for 2 min, 95°C for 10 min, 40 cycles of 95°C for 15 s and 60°C for 30 s. The fold change was obtained using the comparative threshold (2^−ΔΔCT) method using GAPDH as a calibrator.

Non-infected and 12, 24, and 48 h post-RSV infected mice were sacrificed and whole lungs, intestines, brains, and spleens were removed. Total RNA was extracted from the tissues using TRIzol Reagent (Invitrogen, USA) and an RNA Extraction Kit (TR205, Tianmo Biotech, China). Total RNA concentration and purity were assessed using a NanoDrop 2000, and 1 μg of RNA was used for first-strand cDNA synthesis with a PrimeScript RT Kit (TaKaRa, Japan) according to the manufacturer’s instructions. The cDNA was amplified using a VeriQuest Fast SYBR Green qPCR Kit (Invitrogen, USA) with the following primers: Hpx (forward 5’TAGCTGGCCCATTGCTCATC3’; reverse 5’-GAGGGCTCCCAAGTTCCTTC-3’) and Gapdh (forward 5’-CATCACTGCCACCCAGAAGACTG-3’; reverse 5’-ATGCCAGTGAGCTTCCCGTTCAG-3’). The PCR cycle conditions were: 95°C for 2 min, then 40 cycles at 95°C for 5 s and 60 °C for 30 s. The fold-change was obtained using the 2^-ΔΔCt method with Gapdh calibration. RSV N gene were performed using primers and probes: forward primer, 5’-AGATCAACTTCTGTCATCCAGCAA -3’, reverse primer, 5’-TTCTGCACATCATAATTAGGAGTATCAAT-3’ and probe, 5’-FAM-CACCATCCAACGGAGCACAGGAGAT-BHQ1-3’. The PCR cycle conditions were: 50°C for 2 min, 95°C for 10 min, then 40 cycles at 95°C for 15 s and 60°C for 1 min. For absolute quantification, the RSV N gene copy was calculated using a plasmid DNA standard curve.