Primescript rt master mix perfect real time cdna synthesis kit

Total RNA was extracted using the TransZol Up reagent kit (TRANS, Beijing, China) and treated with RNase-free DNase I (TRANS, Beijing, China) following the manufacturer’s instructions. The RNA quality was analysed by agarose gel electrophoresis and quantified using a Nanodrop 2000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA). Only RNAs that met the criteria 260/280 ratio of 1.8–2.1 and 260/230 ratio ≥ 2.0 were used for further analyses and stored at −80 °C.
The RNA was used to synthesise first-strand cDNA using a PrimeScript RT Master Mix (Perfect Real Time) cDNA Synthesis Kit (TaKaRa, Japan). DNAMAN software was used to design the qRT–PCR primers (Table S1). The efficiency of the qPCR was verified for each primer pair using the cDNA of longan somatic embryos (Figure S2). Additionally, qRT-PCRs were performed on a Roche Lightcyler 480 instrument using SYBR Green chemistry (Hieff qPCR SYBR Green Master Mix, YEASEN, China). DlFeSOD (EU330204) was used as a reference gene for the internal control [120 (link)]. The operating parameters of the qRT–PCR were as follows: 95 °C for 30 s, followed by 40 cycles of 95 °C for 10 s and 58 °C for 30 s. The relative expression of the genes involved in SL biosynthesis and signalling in longan was calculated via the 2^−ΔΔCt method [121 (link)].

Total RNA from BMMs stimulated with RANKL in the presence or absence of ceritinib for 5 days, was extracted using the RNA miniprep kit (Axygen, AZ, USA) according to the manufacturer’s protocol. Then, cDNA was synthesized from total RNA using the PrimeScript RT Master Mix (Perfect Real Time) cDNA synthesis kit (RR036, Takara Bio Inc., Dalian, China) according to the manufacturer’s instructions. RT-qPCR was performed on the ABI Flex 6 real-time PCR System (Applied Biosystems, CA, USA) using the TB Green^® Premix Ex Taq™ (Tli RNaseH Plus) (RR420, Takara Bio Inc., Dalian, China). Each reaction was performed in triplicate. Primer sequences of osteoclastogenesis-related genes are listed as follows: (1) Ctsk forward: 5’ TAGCCACGCTTCCTATCCGA ‘3, reverse: 5’ CCTCCGGAGACAGAGCAAAG ‘3; (2) Nfatc1 forward: 5’ TGTTCCTGGCAATAGCGTGT ‘3, reverse: 5’ AGGGTCGAGGTGACACTAGG ‘3; (3) Acp5 forward: 5’ CCTCCGGAGACAGAGCAAAG ‘3, reverse: 5’ CATCGTCTGCACGGTTCTG ‘3; (4) Gapdh forward: 5’ ACCCAGAAGACTGTGGATGG ‘3, reverse: 5’ CACATTGGGGGTAGGAACAC ‘3. Relative fold changes in gene expression were calculated using the comparative CT (2^−ΔΔCT) method.