Real-time PCR was performed as per our published method [11 (link), 12 (link)]. Total RNA was isolated from the quadriceps muscles of mice. The muscle was homogenized and dissolved in TRIzol. RNA was isolated using the TRIzol method following the manufacturer's instructions, and the quality of the RNA preparations was monitored by absorbance at 260 and 280 nm (Helios Gamma, Thermo Spectronic, Rochester, NY). The RNA was reverse-transcribed into complementary deoxyribonucleic acid (cDNA) using iScript reagents from Bio-Rad on a programmable thermal cycler (PCR Sprint, Thermo Electron, Milford, MA). The cDNA (50 ng) was amplified by real-time PCR using a Bio-Rad iCycler and ABgene reagents (Fisher Scientific, Pittsburgh, PA) and ARG1 primers [12 (link)]. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal control for normalization.
Abgene reagents
Manufactured by Thermo Fisher Scientific
ABgene reagents are a suite of high-quality laboratory consumables designed for use in molecular biology and genomics applications. These reagents, which include buffers, enzymes, and other essential components, are engineered to provide consistent and reliable performance in a variety of experimental protocols.
Automatically generated - may contain errors
Lab products found in correlation
5 protocols using abgene reagents
1
Quantification of Arg1 Expression in Murine Muscle
2
Total RNA Isolation from Mouse Tibia
3
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the frozen tissues using trizol method. The tissues were ground in liquid N 2 with a mortar and pestle, dissolved in Trizol for RNA isolation, per manufacturer's instructions, and the quality of the RNA preparations was monitored by absorbance at 260 and 280 nm (Helios-Gamma, Thermo Spectronic, Rochester, NY). The RNA was then reverse-transcribed into complementary deoxyribonucleic acid (cDNA) using iScript reagents from Bio-Rad on a programmable thermal cycler (PCR-Sprint, Thermo Electron, Milford, MA). 50 ng of cDNA was amplified in each real-time PCR reaction using a Bio-Rad iCycler, ABgene reagents (Fisher scientific), and gene-specific primers (Table 1). Average of Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and 18S was used as the internal control for normalization. Standard curves were applied for each RNA assay to produce accurate quantification of the threshold cycle (∆Ct). This allows an approximate comparison of the expression levels of different targets.
4
RNA Isolation and qRT-PCR Analysis of OA Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from OA1 and OA3 grade tissues. The tissues were ground in liquid N2 with a mortar and pestle, dissolved in Trizol for RNA isolation, per manufacturer’s instructions, and the quality of the RNA preparations was monitored by absorbance at 260 and 280 nm (Helios-Gamma, Thermo Spectronic, Rochester, NY). The RNA was then reverse-transcribed into complementary deoxyribonucleic acid (cDNA) using iScript reagents from Bio-Rad on a programmable thermal cycler (PCR-Sprint, Thermo Electron, Milford, MA). 50 ng of cDNA was amplified in each real-time PCR reaction using a Bio-Rad iCycler, ABgene reagents (Fisher scientific) and gene specific primers for HuSVCT2-F GCAGAGCTGTTGCACACAGAA, HuSVCT2-R CGAGGAGGCCGATGACTACTT [9 (link)], HuGAPDH-F CATGAGAAGTATGACAACAGCCT HuGAPDH-R AGTCCTTCCACGATACCAAAGT accession number XM_005253678 and Hu18S-F CAGCCACCCGAGATTGAGCA, Hu18S-F TAGTAGCGACGGGCGGTGTG accession number NR_003286). Average of Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and 18S was used as the internal control for normalization.
5
Quantitative RT-PCR Analysis of Gene Expression
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!