Imdm glutamax

K562 (human erythroleukemia) cell line (American Type Culture Collection, Rockville, MD, USA) was grown between 2 × 10⁵ and 1.5 × 10⁶ cells/mL in Iscove’s Modified Dulbecco’s Medium (IMDM) glutamax (ThermoFisher Scientific, Illkirch, France) supplemented with FBS 10% and Gibco™ Antibiotic-Antimycotic at 37 °C with humid 5% CO₂ atmosphere. Cells were counted by trypan blue counting in a Malassez cell or CASY cell counter (OMNI life science, Bremen, Germany) and used for less than 20 passages.
During the exponential growth phase, 10⁶ K562 cells were co-transfected by electroporation using the Amaxa^® Cell Line Nucleofector^® kit V (Lonza, Basel, Switzerland) with 1 µg human Stomatin Homology-Directed DNA Repair (HDR) plasmids containing a puromycin resistance gene and 3 µg of human Stomatin CRISPR/Cas9 KO plasmids and 3 µg of human Stomatin CRISPR/Cas9 KO plasmids (Santa Cruz Biotechnology, Dallas, TX, USA). Immediately after the transfection, cells were transferred into 2 mL of culture medium to which 5 µg/mL of puromycin (Santa Cruz Biotechnology, Dallas, TX, USA) were added 24 h post-transfection. The expression of both plasmids was stabilized for 3 weeks by keeping puromycin in the culture medium. puromycin-resistant cells were then subjected to a limiting dilution cloning in 96-well microplates before expanding for flow cytometry analysis of several clones.

All experiments performed in vitro were performed using Yssel’s media: IMDM + Glutamax (ThermoFisher scientific), BSA 0.25% (w/v) (Sigma), 2-aminoethanol (1.8 μg/L) (Sigma), Apo-transferrin (40 μg/L) (Sigma), Insulin (5 μg/L) (Sigma), supplemented with 2% human AB serum (EFS), in wells pre-seeded the night before with ~2000 OP9 or OP9-DLL4 stromal cells^{22 (link)}. The cytokines IL-2, IL-7 (Miltenyi Biotec), IL-1β and IL-23 (Peprotech) were added in the combinations indicated at 50 ng/ml for bulk culture and 10 ng/ml for single cell cloning. For bulk culture, 1000–3000 FACS sorted cells were plated onto stromal cells. For cloning, cells were directly sorted into the 96-well plates using index sorting. Media was changed every 2–3 days for bulk cultures and every 4–5 days for single cell cloning. Bulk cultures were analyzed after 5–7 days and cloning experiments after 13 days.

MuTu DCs stably expressing Cas9^{59 (link)} were cultured in Iscove’s Modified Dulbecco’s Medium (IMDM)-GlutaMax™ (Thermo Fisher Scientific) supplemented with 10% (v/v) (FCS), 100 μM β-mercaptoethanol (Thermo Fisher), 100 μg/mL penicillin and 100 μg/mL streptomycin (University of Melbourne Media Preparation Unit) at 37 °C, 10% CO₂. To knockout FcRn, the LV04 vector containing the sgRNA was used (Sigma Aldrich). sgRNA sequences were as follows: non-targeting control: 5’ CGCGATAGCGCGAATATATT 3’; FcRn: 5’ CCGTCGGCCCCTCTCCAGG 3’. To produce lentivirus, HEK293T were transfected using polyethylenimine (Polysciences) with sgRNA vector, pMDL (Addgene #12251), pRSV-REV (Addgene #12253), pMD2.G (Addgene #12259). Lentivirus were subsequently used to transduced Cas9⁺ MuTu DCs by spinfection in the presence of polybrene (Sigma-Aldrich). Transduced cells were then selected by culturing them for three days with puromycin (Thermo Fisher Scientific).

GPSCs (129Sv/C57B (H2^b)), derived from mouse SSCs, were cultured and induced to differentiate into hepatocytes in IMDM complete media containing IMDM-Glutamax (Invitrogen), 9% FCS, 300 μmol/L mercaptoethanol, 100 U/ml penicillin, 100 μg/ml Streptomycin, 1mM sodium pyruvate, and 1x non-essential amino acids (NEAA) (Invitrogen). Feeder-free GPSCs were cultured in hanging drops (300 cells/drop) in the absence of LIF, and at Day 2, embryoid bodies (EBs) were plated on gelatin for further differentiation. The following factors were added: 20ng/ml acidic fibroblast growth factor (FGF) and 10ng/ml basic FGF from Day 6; 10ng/ml rat recombinant hepatocyte growth factor (HGF, Peprotech) from Day 10; 10ng/ml recombinant mouse oncostatin M (R&D systems), 10⁻⁷ M dexamethasone and 1x ITS solution (Sigma) from Day 16 (Fig 1A)[16 (link)]. At Day 13, EBs were trypsinised for cell sorting as described below.