P53 morpholino

Zebrafish strains used in this study were the golden strain and the islet-1-GFP transgenic line (Tg(islet-1:GFP), expressing GFP driven by the islet-1 promoter)23 (link). All zebrafish procedures were performed under Home Office UK licence regulations. Zebrafish embryos were collected and raised at 28.5 °C according to standard procedures52 (link) and staged in hpf or dpf according to standard criteria53 (link) PTU (0.003%; Sigma) was used to suppress pigmentation when necessary. The p53 morpholino was purchased from Gene Tools (Pilomath, OR).

2 nL of a 10-μL injection mix, comprised of 100 ng krt4:EGFP-CAAX, 150 ng krt4:EGFP-dt-KRas^V12, krt4:EGFP-T2A-KRas^V12, or UAS:EGFP-KRas^{V12 17 (link)}, or 200 ng krt4:mCherry-T2A-cMyc + 200 ng transposase mRNA + 1 μL phenol red (Sigma) in nuclease-free dH₂O (Ambion), was microinjected into one-cell embryos. Some experiments included 0.2 pmol p53 morpholino (Gene Tools, 5′-GCGCCATTGCTTTGCAAGAATTG-3′) or 25 ng α-bungarotoxin mRNA^{35 (link)}. Embryos were sorted for expression of transgenes at 1 dpf using a fluorescence dissection microscope, dechorionated with forceps at 1 or 2 dpf or with 1 mg/mL pronase, incubated in E3 with 0.003% N-phenylthiourea (PTU-E3, Merck), and prepared for live imaging or fixed and immunostained. Our studies were not blinded as injected embryos are very easy to visually distinguish, owing to the development of epidermal cell masses in EGFP-KRas^V12 embryos (both “dt” and “T2A” versions), absent in the majority of EGFP-CAAX embryos (see Results, Fig. 1A, and Supplementary Fig. 3A). All zebrafish embryos and adults were treated ethically in compliance with our UK Project Licence P946C972B.

P53 morpholino, bid morpholino and control morpholinos were purchased from Gene Tools LLC (all the sequences are listed in Table S1). Capped mRNAs (bcl2-mCherry) were transcribed from linearized PCS2+ plasmids (mMessage Machine; Ambion), purified, and diluted to 100 ng/ml for injection at the 1-cell stage of development.

To inhibit RGC formation, atoh7 morpholino (5’-TTCATGGCTCTTCAAAAAAGTCTCC-3’) (Gene Tools) was injected at 2 ng per embryo into the yolk of one-cell embryos. p53 morpholino (5’- GCGCCATTGCTTTGCAAGAATTG-3’) (Gene Tools) was co-injected at 2–4 ng per embryo to reduce toxicity and cell death.

Wild-type zebrafish (Danio rerio; AB type) were raised under standard library conditions, and embryo stages were determined as previously described
[38 (link), 39 (link)]. RPS24 Morpholino (5- TGACAGTGACTGTGTCGTTCATCTT-3), RPS24 control MO (5-TGAAAGTAACTGTGACGGTCGTATT-3), miR-142-3p Morpholino (5-TCCATAAAGTAGGAAACACTACACT-3), miR-142-3p control Mo (5-TCaAaAAAtTAcGAAACgCTACACT-3) and p53 Morpholino (5- GCGCCATTGCTTTGCAAGAATTG-3) were obtained from Gene-Tools, LLC (Philomath, OR, USA). Based on our initial trials, 0.5 ng of RPS24 MO and control MO, 20 umol/L miR-142-3p duplexes (Ribo Company, Guangzhou, China), 2 ng miR-142-3p MO and control MO in Danieau’s buffer were chosen as the optimal concentration, which showed significant decrease in O-staining signal, but no obvious morphological defects when compared with the control embryos. The O-dianisidine (Sigma-Aldrich Company, Saint Louis, USA) staining protocols were as previously described
[18 (link), 40 (link)]. All the studies of zebrafish were approved by the Animal Care and Use Committee of Huazhong University of Science and Technology.

p53 morpholino injection was used to assess that the observed phenotype is not a consequence of upregulation of p53-mediated apoptosis caused by off-target effects. p53 morpholino was designed and synthesized by Gene Tools (Philomath, OR, USA). Its sequence is: 5′GCGCCATTGCTTTGCAAGAATTG3′. It was injected into one-cell-stage embryos in a volume of 3–5 nL/embryo and at a concentration of 1 mM.