The expression level of miR-506 was detected in both colorectal cancer tissues and cell lines. According to the manufacturer's instructions, total miRNA was extracted from cells and tissues with TRIzol reagent (Invitrogen). Reverse transcription and qRT-PCR reactions were performed with a SYBR Green-containing PCR kit (GenePharma, China). The cycling conditions were: one cycle at 95 °C for 5 minutes and 38 cycles of 95 °C for 30 se and 55 °C for 30 sec. Melting curve analysis was performed for each PCR reaction to confirm the specificity of the amplification. The expression of miR-506 was calculated based on the threshold cycle (CT), and relative expression levels were calculated as 2–[(CT of miR-506)–(CT of U6)] after normalization with reference to the quantification of U6 small nuclear RNA (snRNA) expression. U6 snRNA was used as an endogenous control. The 5’→3’ primer sequences used for qRT-PCR were as follows: TET1 forward, CCTAGGACA-GGCCTTTGGTG and reverse, CTGGGACAACACTCCCA-CTC; TET2 forward, AGAGAATCCACCTGCAAGCT and reverse, TGGGGTGTGGCTATCAAGTT; TET3 forward, CAACGGCTGCAAGTATGCTC and reverse, CTCGTTGGT-CACCTGGTTCT; and GAPDH forward, GACTCATGACC-ACAGTCCATGC and reverse, AGAGGCAGGGATGATGTT-CTG.
Sybr green containing pcr kit
Manufactured by GenePharma
Sourced in China
The SYBR-green-containing PCR kit is a laboratory reagent used for the quantitative real-time polymerase chain reaction (qPCR) technique. It contains the SYBR green fluorescent dye, which binds to double-stranded DNA and emits a signal that can be detected and measured during the PCR amplification process.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Amv reverse transcriptase, by Promega (2 mentions)
Trizol extraction kit, by Thermo Fisher Scientific (1 mentions)
Iqtm5 multicolor real time pcr detection system, by Bio-Rad (1 mentions)
8 protocols using sybr green containing pcr kit
1
Quantifying miR-506 Expression in Colorectal Cancer
2
Quantifying LMO3 mRNA in Glioma Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from glioma cells using Trizol (Life Technologies, Rockville, MD, USA). For real-time PCR, 2 mg of the total RNA was reverse-transcribed using a cDNA synthesis kit (Fermentas, Burlington, ON, Canada). The β-actin gene was used as a control for this reaction. The data were normalized to β-actin levels, and the level of LMO3 mRNA in the glioma cell lines was determined using the 2−ΔΔCt method. The miR-101 levels were determined using a SYBR-green-containing PCR kit (GenePharma Co.), and the RNA input was normalized to the level of human U6 snRNA.
3
Quantifying Gene Expression in NPCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from NPC and NPE tissues using the Trizol extraction kit (Invitrogen) according to the manufacturer's instructions, and then reversely transcribed into cDNA using AMV reverse transcriptase (Promega, San Luis Obispo, CA, USA). The levels of target gene mRNA transcripts were determined by qRT-PCR using specific primers and a SYBR-green-containing PCR kit (GenePharma, Shanghai, China). The sequences of primers were forward 5'-CTTCCACATCAACTACGGCG-3' and reverse 5'-CTCTTCTGCGCTGTCCTCTA-3' for HYOU1 (235 bp); forward 5'-GAAGGTGAAGGTCGGAGTC-3' and reverse 5'-GAAGATGGTGATGGGATTTC-3' for GAPDH (226 bp). The relative levels of individual gene mRNA transcripts to control GAPDH were determined.
4
Quantitative RT-PCR Analysis of CALR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using Trizol (Invitrogen, CA) according to the manufacturer's instructions, and reversely transcribed into complementary DNA using AMV reverse transcriptase (Promega, San Luis Obispo, CA, USA). The levels of target gene mRNA transcripts were determined by qRT-PCR using specific primers and a SYBR-green-containing PCR kit (GenePharma, Shanghai, China). The sequences of primers were forward 5'-TCTCAGTTCCGGCAAGTTCT-3' and reverse 5'-TTCTGAGTCTCCGTGCATGT-3' for CALR (232 bp); forward 5'-GAAGGTGAAGGTCGGAGTC-3' and reverse 5'-GAAGATGGTGAT GGGATTTC-3' for GAPDH (226 bp). The relative levels of individual gene mRNA transcripts to control GAPDH were determined.
5
Quantifying PRDM16 and miR-101 in Glioma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from glioma cells using TRIzol (Life Technologies, Rockville, MD, USA). For real-time PCR, 2 mg of the total RNA was reverse- transcribed using a cDNA synthesis kit (Fermentas, Burlington, ON, Canada). The β-actin gene was used as a control for this reaction. The data were normalized to β-actin levels, and levels of PRDM16 mRNA in the astrocytoma cell lines were determined using the 2−ΔΔCt method. The miR-101 levels were determined using a SYBR-green-containing PCR kit (GenePharma Co.), and the RNA input was normalized to human U6 snRNA levels.
6
qRT-PCR Analysis of miRNA and mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNAs were extracted from cells or tissues with TRIzol reagent (Invitrogen, Wuhan, China). Reverse transcription reactions were performed with reagents from a SYBR-green-containing PCR kit (GenePharma, Shanghai, China). The primers for qRT-PCR detection of miRNA were designed based on the miRNA sequences provided by the Sanger Center miRNA Registry and were synthesized and purified by Shanghai GenePharma. Human U6 small nuclear (sn)RNA was used for normalization. Primers used are as follows: miR-182, 5′-ACTTTTGGCAATGGTAGAACTCAC-3′ and 5′-AATCCATGAGAGATCCCTAGCG-3′ ; miR-381, 5′-TAATCTGACTATACAAGGGCAAGCT-3′ and 5′-TATGGTTGT TCTGCTCTCTGTCTC-3′ ; and U6 snRNA, 5′-ATTGGAACGATACAGAGAAGATT-3′ and 5′-GGAACGCTTCACGAATTTG-3′ . The primers for qRT-PCR detection of LRRC4 or BRD7 mRNA were synthesized by Invitrogen as follows: LRRC4, 5′-GCCGCCATGTTGATTGTC-3′ and 5′-GTGCTGGTTTGTAGGTGTTGTA-3′ ; and BRD7, 5′-TCTTGGGTCCCTCATACA-3′ and 5′-ACTCAGCAACATCCGTCT-3′ . mRNA expression was normalized to β-actin. Primers for β-actin were 5′-AGCGAGCATCCCCCAAAGTT-3′ and 5′-GGGCACGAAGGCTCATCATT-3′ . All real-time PCR was performed on the Bio-Rad IQTM5 Multicolor Real-Time PCR Detection System (USA).
7
Quantification of miR-200b in Breast Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Expression level of miR-200b was detected in both breast cancer tissues and cell lines. 40 pairs of tumor tissues and para-carcinoma tissues from breast cancer patients were obtained. Human mammary epithelial cell line 184A, MCF-10A, and several breast cancer cell lines were also included. Total RNAs were extracted from tissues/cells with TRIzol reagent (Invitrogen). For miR-200b, reverse transcription and qRT-PCR reactions were performed by means of a SYBR-green-containing PCR kit (GenePharma, Shanghai, China). U6 snRNA was used as an endogenous control for miRNA detection. The expression of miR-200b was quantified by measuring cycle threshold (Ct) values and normalized using the 2-ΔΔCt method relative to U6 snRNA.
8
Quantification of AMPK α-subunit mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For AMPK α-subunit (AMPKα1) mRNA qualification, reverse transcription and qRT-PCR reactions were performed by means of a SYBR-green-containing PCR kit (GenePharma, Shanghai, China). U6 snRNA was used as an endogenous control for miRNA detection. The expression of AMPK mRNA was quantified by measuring cycle threshold (Ct) values and normalized using the 2-ΔΔCt method relative to U6 snRNA.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!