Total RNA was extracted from the cells using Trizol (LEAGENE, China) method. Then, 1 μg of RNA was reverse transcribed into cDNA with the HiFiScript cDNA Synthesis (CWBIO, China). RT‐PCR assay was performed follow the instruction manual of UltraSYBR Mixture (CWBIO, China). RT‐PCR reaction program was set to two steps: (a) preincubation at 95°C for 30 s; (b) 95°C for 5 s, 55°C for 30 s and 72°C for 34 s for 40 cycles. Relative expression was evaluated by the 2−ΔΔCt method with GAPDH as an endogenous control. Primer sequences were listed as follows: DCTPP1 forward: 5′‐TCCATCAGCCTCGGAATCTCCT‐3′, reverse: 5′‐CCTCTTGAAGGGCTGCCCGTT‐3′ and GAPDH forward: 5′‐GAGTCAACGGATTTGGTCGT‐3′, reverse: 5′‐TTGATTTTGGAGGGATCTCG‐3′. Samples were assayed in triplicate using the ABI Prism 7500 detection system (Applied Biosystems, United States).
Trizol
Manufactured by Leagene
Sourced in China
TRIzol is a ready-to-use reagent designed for the isolation of total RNA from various biological samples. It is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components that facilitates the separation of RNA from DNA and proteins during the RNA extraction process.
Automatically generated - may contain errors
Lab products found in correlation
Quantstudio 3 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Abi prism 7500 detection system, by Thermo Fisher Scientific (1 mentions)
Ultrasybr mixture, by CWBIO (1 mentions)
Kyse150, by Procell (1 mentions)
Pmsf protease inhibitor, by Solarbio (1 mentions)
Eca 109, by Procell (1 mentions)
Ripa lysis buffer, by Solarbio (1 mentions)
Faststart essential dna green master mix, by Roche (1 mentions)
Revertra ace qpcr rt master mix with gdna remover, by Toyobo (1 mentions)
3 protocols using trizol
1
RT-qPCR Analysis of DCTPP1 Expression
2
RT-qPCR and Protein Analysis of ZPR1 in ESCC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human ESCC cell lines KYSE150, Eca109, TE1, and the normal esophageal cell line HEEC, obtained from Procell Life Science & Technology Co., Ltd, were maintained in a 5% CO2 incubator at 37°C in T25 culture flasks.
The total RNA was extracted using TRIzol (LEAGENE) from cell lines in the logarithmic growth phase and in good growth condition, and was inverted into cDNA using the RevertAid First Strand cDNA Synthesis Kits (Novoprotein). Gene‐specific primers used for RT‐qPCR were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The primers for ZPR1 were 5′‐CGC CTCCT GCTC ACCA AGATTC‐3′ (forward) and 5′‐CCGACTGGATCTC CGTGTTGTTC‐3′ (reverse), and for GAPDH were 5′‐CGGAGTCAACGGATTTGGTCGTAT‐3′ (forward) and 5′‐AGCCT TCTCCATG GTGGTGAAGAC‐3′ (reverse). The total proteins were extracted using RIPA lysis buffer and PMSF protease inhibitor (Solarbio), and the bicinchoninic acid (Dingguo) method was used to determine the concentration of total proteins, and then equal amounts of protein were loaded and separated using SDS‐PAGE.
The total RNA was extracted using TRIzol (LEAGENE) from cell lines in the logarithmic growth phase and in good growth condition, and was inverted into cDNA using the RevertAid First Strand cDNA Synthesis Kits (Novoprotein). Gene‐specific primers used for RT‐qPCR were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The primers for ZPR1 were 5′‐CGC CTCCT GCTC ACCA AGATTC‐3′ (forward) and 5′‐CCGACTGGATCTC CGTGTTGTTC‐3′ (reverse), and for GAPDH were 5′‐CGGAGTCAACGGATTTGGTCGTAT‐3′ (forward) and 5′‐AGCCT TCTCCATG GTGGTGAAGAC‐3′ (reverse). The total proteins were extracted using RIPA lysis buffer and PMSF protease inhibitor (Solarbio), and the bicinchoninic acid (Dingguo) method was used to determine the concentration of total proteins, and then equal amounts of protein were loaded and separated using SDS‐PAGE.
3
Quantitative Analysis of GPM6B Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol (NR0002, Leagene, China). Then, total RNA was reverse transcribed into cDNA using ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO, Japan). Gene transcripts were quantified on a QuantStudio 3 Real-Time PCR System (Thermo Fisher, USA) using the FastStart Essential DNA Green Master Mix (Roche, USA), and the expression was normalized to that of GAPDH. The raw data are presented as the relative expression level, which was calculated using the 2-△△Ct method. The primers (Sangon Biotech, China) used for qPCR were listed as below: GPM6B: 5′-TGAGCGAGGTGATACAACTGATGC-3′ and 5′-GCCACTCCAAGCACATAGGTGAG-3′; GAPDH: 5′-CGGAGTCAACGGATTTGGTCGTAT-3′ and 5′-AGCCTTCTCCATGGTGGTGAAGAC-3′.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!