The largest database of trusted experimental protocols

Luciferase assay

Manufactured by Thermo Fisher Scientific
Sourced in United States

The Luciferase assay is a quantitative method used to measure the activity of the luciferase enzyme, which catalyzes the oxidation of the substrate luciferin, resulting in the emission of light. The amount of light produced is proportional to the luciferase enzyme activity present in the sample.

Automatically generated - may contain errors

3 protocols using luciferase assay

1

Measure COX-2 Activity Using Luciferase Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
A COX-2-luc plasmid was synthesized to measure COX-2 luciferase activity. A region extended from −459 bp to +9 bp of the COX-2 promoter gene was cloned into the pGL3-basic vector (purchased from Promega Corporation, Fitchburg, WI, USA). Subsequently, HaCaT cells were transfected with the COX-2-luc plasmid, and the COX-2 luciferase activity was determined using the luciferase assay (Promega Corporation). Following various treatments, 5 μL of the supernatant was added to 50 μL luciferase assay solution, and luminescence was measured using a Fluoroskan Ascent FL luminometer (Thermo Fisher Scientific). All experiments were performed at least three times.
The fragment sequence of the COX-2 promoter region was as follows: GACGTACAGACCAGACACGGCGGCGGCGGCGGGAGAGGGGATTCCCTGCGCCCCCGGACCTCAGGGCCGCTCAGATTCCTGGAGAGGAAGCCAAGTGTCCTTCTGCCCTCCCCCGGTATCCCATCCAAGGCGATCAGTCCAGAACTGGCTCTCGGAAGCGCTCGGGCAAAGACTGCGAAGAAGAAAAGACATCTGGCGGAAACCTGTGCGCCTGGGGCGGTGGAACTCGGGGAGGAGAGGGAGGGATCAGACAGGAGAGTGGGGACTACCCCCTCTGCTCCCAAATTGGGGCAGCTTCCTGGGTTTCCGATTTTCTCATTTCCGTGGGTAAAAAACCCTGCCCCCACCGGGCTTACGCAATTTTTTTAAGGGGAGAGGAGGGAAAAATTTGTGGGGGGTACGAAAAGGCGGAAAGAAACAGTCATTTCGTCACATGGGCTTGGTTTTCAGTCTTATAAAAAGGAAGG.
+ Open protocol
+ Expand
2

Luciferase Assay for miR-92a-1-5p Targeting

Check if the same lab product or an alternative is used in the 5 most similar protocols
For luciferase assay, the 3′UTR of Slc2a5 harbouring predicted seed matches for miR-92a-1-5p was cloned in a PsiCheck2 vector (Promega, Madison, WI, United States, C8021). HEK293 cells were transfected with 1 µM mmu-miR-92-1-5p-mimic (Horizon discoveries, Waterbeach, United Kingdom, MIMAT0017066) or non-targeting control (Horizon, CN-001000-01–05) and 0.2 µg PsiCheck2 vector using lipofectamine 3,000 (Thermo Fisher Scientific, Waltham, MA, United States, as transfection reagent. The medium was changed after 24 h of transfection and luciferase assay was performed on day 2 after transfection. The luciferase assay was performed according to the manufacturer’s instructions (Thermo Fisher Scientific, Waltham, MA, United States, 16185).
+ Open protocol
+ Expand
3

Quantifying Ovarian ATP Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols
Ovaries were homogenized with 50μl of lysis buffer (Promega, Madison, WI, USA) for 30 seconds on ice using a disposable micro-pestle in a 1.5mL micro-centrifuge tube, and supernatant was analyzed using an ATP kit utilizing a luciferase assay (ThermoFisher Scientific, Waltham, MA) following kit instructions.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!