Total RNA was extracted from 0.5 g frozen peel tissue from the control and ATF-treated Ponkan fruit following the procedures described by Ma et al. (2014) (link). The quality and quantification of RNA were determined using 1.0% agarose gel electrophoresis and a NanoDrop 2000 spectrophotometer, respectively. The synthesis of first-strand cDNA was performed using a Hifair II first-strand cDNA synthesis kit (Yeasen, Shanghai, China). The gene expression patterns of MnSOD1 (Ponkan7g_002820), CAT1 (Ponkan2g_014350), POD1 (Ponkan4g_000980), APX1 (Ponkan2g_006070), GR2 (Ponkan5g_040100), MDHAR5 (Ponkan5g_022520), DHAR3 (Ponkan7g_004490), GST3 (Ponkan5g_037340), and GPX2 (Ponkan5g_023250) in Ponkan fruit were analyzed by qRT-PCR and designed using Primer Express 5.0. The citrus β-actin (Ponkan1g_003790) gene was used as the internal control gene for each gene amplification. All qRT-PCR was performed triplicates in a 10-μl mixture containing 1.0 μl of diluted cDNA, 0.3 μl of each gene-specific primer (1 μM, Supplementary Table 1 ), 5 μl of TB Green Premix Ex Taq and 3.4 μl of nuclease-free water. The PCR protocol was as follows: an initial denaturation at 95°C for 1 min, followed by 40 cycles at 95°C for 15 s, and a primer extension at 63°C for 25 s. The relative expression of each targeted gene was calculated by the 2–ΔΔCt method with three biological replicates.
Hifair 2 first strand cdna synthesis kit
Manufactured by Yeasen
Sourced in China
The Hifair II First Strand cDNA Synthesis Kit is a lab equipment product that enables the conversion of RNA into complementary DNA (cDNA) through reverse transcription. This kit provides the necessary reagents and protocols to perform this fundamental step in various molecular biology and genomics applications.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (2 mentions)
Quantstudio 3, by Thermo Fisher Scientific (2 mentions)
Qpcr sybr green master mix kit, by Yeasen (2 mentions)
Mirna oligonucleotide primers, by Qiagen (2 mentions)
Sybr green master mix, by Qiagen (2 mentions)
Sds software, by Thermo Fisher Scientific (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Hieff qpcr sybr green master mix, by Yeasen (2 mentions)
Trizol reagent, by Takara Bio (1 mentions)
Lightcycler 480 instrument 2, by Roche (1 mentions)
Hifair qpcr sybr green master mix, by Yeasen (1 mentions)
Tri reagent solution, by Thermo Fisher Scientific (1 mentions)
Cfx connect real time pcr detection system, by Bio-Rad (1 mentions)
Hiseq 4000, by Illumina (1 mentions)
Triquick reagent, by Solarbio (1 mentions)
Applied biosystems 7300 system, by Thermo Fisher Scientific (1 mentions)
10 protocols using hifair 2 first strand cdna synthesis kit
1
Citrus Antioxidant Gene Expression Analysis
2
Anti-inflammatory Effects of ZVMNs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To assess the anti-inflammatory effect, iBMDM cells were seeded into six-well plates, which were stimulated by LPS (1 μg/ml) and then incubated with 50-ppm ZVMNs. The total RNA of cell and mice colon tissue was extracted by TRIzol reagent (Takara) and then transcribed into cDNA by the Hifair II First Strand cDNA Synthesis Kit (Yeasen). Next, quantitative polymerase chain reaction (qPCR) was performed using Hieff qPCR SYBR Green Master Mix (Yeasen) on LightCycler 480 Instrument II (Roche). The following qPCR conditions were used: 40 cycles of denaturation at 95°C for 10 s and annealing at 60°C for 30 s. A comparative threshold cycle method was used to analyze the qPCR data, where the amount of target was normalized to the endogenous reference of β-actin in each sample. The primer sequences used were as follows: β-actin (forward: CGTTGACATCCGTAAAGACC; reverse: TAGGAGCCAGAGCAGTAATC), IL-10 (forward: CAGGGATCTTAGCTAACGGAAA; reverse: GCTCAGTGAATAAATAGAATGGGAAC), TNF-α1 (forward: CAGGCGGTGCCTATGTCTC; reverse: CGATCACCCCGAAGTTCAGTAG), IL-1β (forward: TTCAGGCAGGCAGTATCACTC; reverse: GAAGGTCCACGGGAAAGACAC), IL-6 (forward: CTGCAAGAGACTTCCATCCAG; reverse: AGTGGTATAGACAGGTCTGTTGG), and IFN-γ (forward: GCCACGGCACAGTCATTGA; reverse: TGCTGATGGCCTGATTGTCTT).
3
Quantitative Real-Time PCR Analysis of METTL3 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real‐time PCR was performed as previously described.3 , 20 Total mRNA was extracted with TRI Reagent® Solution (A33251, Invitrogen), and 5 μg of total mRNA was reverse transcription into cDNA by using Hifair® II first Strand cDNA Synthesis Kit (gDNA digester plus; 11119ES60, Yeasen). Then, the mRNA levels of target genes were detected by using Hifair® qPCR SYBR® Green Master Mix (No Rox; 11201ES08, Yeasen) in CFX connect™ real‐time PCR detection system (Bio‐Rad). Primers used in this study were as follow: METTL3 forward primer 5′‐TGGGGGTATGAACGGGTAGA‐3′ and reverse primer 5′‐TGGTTGAAGCCTTGGGGATT‐3′.
4
Gene Expression Analysis of Brain Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted from brain tissues with ice-cold Trizol (Invitrogen, USA), and then reverse-transcribed into cDNA using Hifair II first strand cDNA synthesis kit (Yeasen, China). Following the directions of qPCR SYBR Green Master Mix kit (Yeasen, China), the cDNA samples were amplified on QuantStudio3 (Appliedbiosystems, USA). The relative expression of target gene was calculated via the 2−ΔΔCt method with β-actin as the internal reference. The primers used are listed in Supporting Information Table S1 .
5
Gene Expression Analysis of Brain Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted from brain tissues with ice-cold Trizol (Invitrogen, USA), and then reverse-transcribed into cDNA using Hifair II first strand cDNA synthesis kit (Yeasen, China). Following the directions of qPCR SYBR Green Master Mix kit (Yeasen, China), the cDNA samples were amplified on QuantStudio3 (Appliedbiosystems, USA). The relative expression of target gene was calculated via the 2−ΔΔCt method with β-actin as the internal reference. The primers used are listed in Supporting Information Table S1 .
6
Illumina RNA-Seq Library Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA library preparation and sequencing were performed using a Hifair II First Strand cDNA Synthesis Kit (gDNA digester plus), produced by the Shanghai Yeasen Biotechnology Company (Shanghai, China). mRNA was isolated using oligo(dT) primers. The mRNA was fragmented into short pieces after the addition of fragmentation buffer, and first-strand cDNA was synthesized with random primers. Then, second-strand cDNA was synthesized using the buffer, deoxyribonucleotide triphosphates (dNTPs), RNase H, and DNA polymerase I. The synthetic cDNA was subjected to end-repair by polymerase with Seloxa adapters, and suitable fragments were retrieved via agarose gel electrophoresis. Polymerase chain reaction (PCR) amplification was carried out to enrich the purified fragments. RNA-Seq was carried out using an Illumina HiSeqTM4000 sequencing platform (Illumina, San Diego, CA, USA).
7
Quantification of mRNA and miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from brain or cell samples using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA). RNA (1 g) was reverse transcribed to cDNA using a Hifair® II First-strand cDNA Synthesis Kit (Yeasen Biotech, Shanghai, China). mRNA expression levels were quantified using a SYBR Green Master Mix (Exiqon, Vedbaek, Denmark), and Ct values for each sample and gene were normalized with respect to glyceraldehyde 3-phosphate dehydrogenase. The expression of miRNA was tested using a fast real-time PCR system (7900 HT, ABI, Foster City, CA) and the appropriate miRNA oligonucleotide primers (Qiagen, Hilden, Germany). The fold-change values were calculated by normalizing with respect to the control samples. PCR amplification was performed for 40 cycles, and the data were collected using SDS software (Applied Biosystems, Foster City, CA). The sequences of the mRNA oligonucleotide primers were used are listed in Table 1 .
The sequences of the mRNA oligonucleotide primers
| Gene | Forward Sequences | Reverse Sequences |
|---|---|---|
| Mouse Tppp3 | AGCGGGCAAGAGATGAATGG | GCAGATTTCGCCTTGACTTTG |
| Mouse Saa3 | TGCCATCATTCTTTGCATCTTGA | CCGTGAACTTCTGAACAGCCT |
| Mouse Nr1d1 | TACATTGGCTCTAGTGGCTCC | CAGTAGGTGATGGTGGGAAGTA |
| Mouse Gapdh | AGGTCGGTGTGAACGGATTTG | TGTAGACCATGTAGTTGAGGTCA |
8
Quantitative Analysis of mRNA and miRNA Expression in Brain Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Brain tissue samples were extracted from the glial scar region under a microscope (Leica, Solms, Germany). Total RNA was extracted from brain or cell samples using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA). RNA (1 µg) was reverse transcribed to cDNA using a Hifair® II First-strand cDNA Synthesis Kit (Yeasen Biotech, Shanghai, China). mRNA expression levels were quantified using a SYBR Green Master Mix (Exiqon, Vedbaek, Denmark), and Ct values for each sample and gene were normalized with respect to glyceraldehyde 3-phosphate dehydrogenase. The expression of miRNA was tested using a fast real-time PCR system (7900 HT, ABI, Foster City, CA) and the appropriate miRNA oligonucleotide primers (Qiagen, Hilden, Germany). The fold-change values were calculated by normalizing with respect to the control samples. PCR amplification was performed for 40 cycles, and the data were collected using SDS software (Applied Biosystems, Foster City, CA). The sequences of the mRNA oligonucleotide primers were used are listed in the table follows:
9
Gene Expression Analysis by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using Triquick Reagent (Solarbio, Beijing, China) according to the manufacturer’s protocol. One microgram of total RNA was reverse transcribed with the Hifair Ⅱ first-strand cDNA synthesis kit (YEASEN, Shanghai, China). An equal amount of cDNA was then amplified by real-time PCR using the Hieff qPCR SYBR Green Master Mix (YEASEN, Shanghai, China) and Applied Biosystems 7300 System (Applied Biosystems, CA, USA). The PCR conditions were as follows: 95°C for 5 min, 95°C for 10 s, and 60°C for 34 s for a total of 40 cycles. Each analysis was performed in quadruplicate. Gene expression was normalized to a housekeeping gene (β-actin) and the relative expression values between the samples were calculated based on the threshold cycle (Ct) value using the 2-ΔΔCT method. Forward and reverse primer sequences for β-actin were 5′-TGCGTGACATCAAAGAGAAG-3′ and 5′-TCCATACCCAAGAAGGAAGG-3′, respectively. Forward and reverse primer sequences for SPARC were 5′-AGGTGTGTGAGCTGCACGAGA-3′ and 5′-GAAGTGGCAGGA AGAGTCGAA-3′, respectively. Forward and reverse primer sequences for TMBIM6 were 5′-AGC AGC ACC TGA AGG TC-3′ and 5′-TCA ATA TCA GGG AGC CCA AG-3′, respectively.
10
Validation of Differential Expression in Shrimp Hepatopancreas
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To validate the accuracy of the result of differential expression, five DEGs and three differentially expressed miRNAs were selected for quantitative real-time PCR. Total RNA from the hepatopancreas of shrimp was isolated with Trizol reagent. mRNA and miRNA were reverse transcribed into cDNA by Hifair® Ⅱ first Strand cDNA Synthesis Kit (Yeasen, China). The primers (Table 1 ) of mRNAs and miRNAs are designed by Guangzhou Regene Biotechnology Co. Ltd. (Guagnzhou, China). β-actin and U6 were used as an internal reference mRNAs and miRNAs, respectively. The qRT-PCR reaction system consists of 5 μl Hieff® qPCR SYBR Green Master Mix (Low Rox Plus), 1 μl forward primer and 1 μl reverse primer, 2 μl cDNA and RNase-free Water to 10 μl. Transcript abundance of mRNA and miRNA were calculated using the comparative 2−△△Ct method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!