Abi 7300 detection system

Total RNA was extracted with TransZol reagent (TransGen, Cat. No. ET111-01) as previously described.^{86 (link)} Thereafter, total RNA was reverse transcribed using the GoldScipt cDNA Synthesis Kit (Invitrogen, Cat. No. C81401190) and subjected to quantitative RT-PCR analysis in an ABI 7300 Detection System (Applied Biosystems) using the SYBR Green PCR Master Mix (Applied Biosystems, Cat. No. 4344463) according to the manufacturer’s instructions. GAPDH served as reference, and the 2^−ΔΔCT method^{87 (link)} was used to analyze the data. The primers used for qRT-PCR were as listed in Supplementary Information, Table S1.

mRNA was isolated from cells using TRIzol reagent (Tiangen Biotech) and reverse-transcribed into cDNA with reverse transcriptase (Fermentas). cDNA was amplified on an ABI7300 Detection System (Applied Biosystems) using SYBR Green PCR Master Mix (Takara) according to the manufacturer’s instructions, and data were normalized by the level of β-actin in each individual sample. The 2^−ΔΔCt method was used to calculate relative expression changes. The gene-specific primers for Q-PCR were: IFN-β: 5′-AGGACAGGATGAACTTTGAC-3′ and 5′-TGATAGACATTAGCCAGGAG-3′; β-actin: 5′-ACGTGGACATCCGCAAAGAC-3′ and 5′-CAAGAAAGGGTGTAACGCAACTA-3′; RNF114: 5′-CGAGAGCACAGAGACTTC-3′ and 5′-AGGACAGTAAGGACAAGGA-3′; RNF125: 5′-CGTTCCTGTATTGCTACCA-3′ and 5′-CTTCTGACAAGTCCGAATATG-3′; RNF138: 5′-GGAACAGCAATAGGAGTGA-3′ and 5′-CTGGTAATCTGGCTAGGATC-3′; RNF166: 5′-AAGGTGACCCTGGCAAAGAT-3′ and 5′-GGGATAGGCTGTGATGTGGG-3′; ISG15: 5′-AGGCAGCGAACTCATCTTTG-3′ and 5′-CCAGCATCTTCACCGTCAG-3′; MX1: 5′-GTTTACCAGACTCCGACACGA-3′ and 5′- TTCCAGTGCCTTGATTTGCT -3′; P protein of SeV: 5′-TGTTATCGGATTCCTCGACGCAGTC-3′ and 5′-TACTCTCCTCACCTGATCGATTATC-3′.

Popliteal lymph nodes were harvest following each designated time point and suspended in RNAlater solution for up to 2 weeks. The harvested RNA was homogenized with prefilled 2 mL, 1.5 mm Zirconium bead tubes at 250 G for 90 secs. The homogenized tissue solution was extracted for RNA following the procedures for RNeasy Mini Kit (Qiagen). cDNA was reverse transcribed using the extracted RNA (KIT). Murine ccr7, cd34, cd28, nfkb1 expression was quantified using Maxima SYBR Green/ROX qPCR Master Mix (Thermo Fisher) in the ABI 7300 detection system (Applied Biosystems). GAPDH gene expression was measured as endogenous reference. The relative fold change was calculated following the 2^-ddCT method^{32 (link)}. Fold change was normalized to the average of non-irradiated mice (non treated group) and UV mice (treated group) of triplicate of 6 different mice in each group.