Transit lt1 transfection reagent

Manufactured by Mirus Bio

Sourced in United States, Germany

TransIT-LT1 is a transfection reagent that facilitates the delivery of nucleic acids, such as plasmid DNA, into a variety of mammalian cell types. It is designed to enable efficient and reliable transfection for research applications.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

TransIT-LT1 (450 citations) TransIT-LT1 reagent (186 citations) LT1 transfection reagent (38 citations) TransIT transfection reagent (35 citations) TransIT reagent (25 citations) Mirus TransIT-LT1 transfection reagent (23 citations) LT1 reagent (11 citations) Transfection reagent (10 citations)

568 protocols using transit lt1 transfection reagent

Cell Culture and Transfection Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols

HEK293T cells were cultured in DMEM (low glucose; FUJIFILM Wako Pure Chemical) supplemented with 10% foetal bovine serum (FBS; FUJIFILM Wako Pure Chemical), 100 unit/ml penicillin and 100 µg/ml streptomycin (Gibco) at 37°C under 5% CO₂. HEK293T cells were transfected using TransIT‐LT1 transfection reagent (Mirus Bio) or PEI Max: Polyethyleneimine “Max” (MW 40,000; PolyScience, Inc.).
HuH7 cells were cultured in DMEM (high glucose; FUJIFILM Wako Pure Chemical) supplemented with 10% FBS (Wako), 100 unit/ml penicillin, 100 µg/ml streptomycin (Gibco), 1 mM Sodium Pyruvate (Gibco), 10 mM HEPES (Gibco) and 1× MEM NEAA (Gibco) at 37°C under 5% CO₂.
THP‐1 cells were cultured in RPMI160 GlutaMAX medium (Gibco) supplemented with 10% FBS (FUJIFILM Wako Pure Chemical), 100 unit/ml penicillin and 100 µg/ml streptomycin (Gibco) at 37°C under 5% CO₂.
TK, HT, BJAB, SU‐DHL‐4, MT‐4 and Raji cells were cultured in RPMI1640 GlutaMAX medium supplemented with 10% FBS (FUJIFILM Wako Pure Chemical), 100 unit/ml penicillin, 100 µg/ml streptomycin (Gibco) and 55 µM 2‐mercaptoethanol (Gibco) at 37°C under 5% CO₂.
DF‐1 cells were cultured in DMEM (low glucose; FUJIFILM Wako Pure Chemical) supplemented with 10% FBS (Wako), 100 unit/ml penicillin and 100 µg/ml streptomycin (Gibco) at 37°C under 5% CO₂. DF‐1 cells were transfected using TransIT‐LT1 transfection reagent (Mirus Bio).

Yamanaka S., Murai H., Saito D., Abe G., Tokunaga E., Iwasaki T., Takahashi H., Takeda H., Suzuki T., Shibata N., Tamura K, & Sawasaki T. (2021). Thalidomide and its metabolite 5‐hydroxythalidomide induce teratogenicity via the cereblon neosubstrate PLZF. The EMBO Journal, 40(4), e105375.

+ Open protocol

+ Expand

Cloning and Transfection of PAR Receptors

Check if the same lab product or an alternative is used in the 5 most similar protocols

A cDNA encoding wild-type human Par2 was kindly provided by Professor Morley D. Hollenberg (Faculty of Medicine, University of Calgary, Alberta, Canada). Etk/Bmx viral vector and GST-PH-Etk/Bmx constructs were kindly provided by Dr Yun Qiu (Departments of Pharmacology and Experimental Therapeutics, University of Maryland School of Medicine, Baltimore, MD, USA). The GST-PH-Akt construct was kindly provided by Dr Brian A. Hemmings (Friedrich Miescher Institute, Basel, Switzerland). The GST-PH-Vav₃ construct was kindly provided by Dr Shan Lu (University of Cincinnati College of Medicine, Cincinnati, OH, USA).
Cells were grown to 70–80% confluency and transfected with 0.1–3.5 μg of plasmid DNA in TransIT LT1 transfection reagent (Mirus Bio LLC, Madison, WI, USA) according to the manufacturer's instructions. Cells were collected 48 h after transfection and protein lysates/RNA were purified.
MCF-7, HU or HEK 293T were grown to 70–80% confluency and transfected with 1–2 μg of either wt human hPar1 or hPar2 or truncated hPar2 (devoid of the cytoplasmic tail) cDNA, or with several hPar2-deleted constructs, or with a control pcDNA3 vector (Invitrogen, Carlsbad, CA, USA) using TransIT LT1 transfection reagent (Mirus Bio LLC). Transfected cells were selected with G418 (800 μg ml⁻¹) to obtain stable populations of cells expressing hPar1 and hPar2, or hPar1 and truncated hPar2.

Kancharla A., Maoz M., Jaber M., Agranovich D., Peretz T., Grisaru-Granovsky S., Uziely B, & Bar-Shavit R. (2015). PH motifs in PAR1&2 endow breast cancer growth. Nature Communications, 6, 8853.

+ Open protocol

+ Expand

Generation of MESH1-Overexpressing Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

Stable RCC4 cell lines with MESH1-WT (RefSeq: NM_001286451.1) or MESH1-E65A expression were generated using lentiviral vector pLX302³⁵ (a gift from David Root, Addgene plasmid #25896) without expression of the V5 tag. Briefly, virus was generated by transfecting HEK-293T cells with a 0.1:1:1 ratio of pMD2.G: psPAX2: pLX302 with TransIT-LT1 Transfection Reagent (Mirus, MIR2305). pMD2.G and psPAX2 were gifts from Didier Trono (Addgene plasmid #12259 and # 12260, respectively). Virus was collected 48 hours after transfection. Stable cell lines were generated by adding 200 μL virus to a 60 mm dish of RCC4 cells with 8 μg/mL polybrene. 1 μg/mL puromycin was used for selection. Complete death in blank infection dishes was used to determine the success of infection and the length of puromycin selection. The efficiency of overexpression was determined by Western blotting.
Transient overexpression of MESH1 in HEK-293T cells for the NADP(H) content assay or enzymology assay was achieved by using the pCMV6-neo vector (OriGene, SC334209). Briefly, 2 × 10⁵ HEK-293T cells were seeded in one well of a 6-well plate for 24 hours, and then 1 μg of the plasmid (pCMV6-neo empty vector or with MESH1-WT or MESH1-E65A) was transfected with TransIT-LT1 Transfection Reagent (Mirus) for additional 48 hours before collection.

Ding C.K., Rose J., Sun T., Wu J., Chen P.H., Lin C.C., Yang W.H., Chen K.Y., Lee H., Xu E., Tian S., Akinwuntan J., Zhao J., Guan Z., Zhou P, & Chi J.T. (2020). MESH1 is a cytosolic NADPH phosphatase that regulates ferroptosis. Nature metabolism, 2(3), 270-277.

+ Open protocol

+ Expand

Generation of MESH1-Overexpressing Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

Evaluating Wnt Signaling Modulation

Check if the same lab product or an alternative is used in the 5 most similar protocols

GBM cells were transfected using a protocol for transient transfection of adherent cells using TransIT®-LT1 Transfection Reagent (Mirus Bio LLC, Madison, WI) with BAT-luciferase reporter construct (BAT-lux) (Addgene plasmid # 20890). This consists of seven TCF/LEF-binding sites upstream of a 0.13-kb fragment containing the minimal promoter-TATA box of the gene siamois driving the expression of Firefly luciferase reporter gene 29 (link). To over-express TCF4 inhibitory isoforms (TCF4E) we used the plasmid pcDNA3.1-TCF4E (Addgene plasmid # 32738). Luciferase experiments were set as follows: at day 1 cells were plated at 2x10⁵ per well and at day 2 transfected with pcDNA3.1-TCF4E or pcDNA3.1. At day 3, cells were transfected with BAT-lux and a pMAX-GFP plasmid as a proper control of transfection efficacy and for normalization purposes. At day 4 cells were treated or not with Wnt3a (30ng/ml) and then at day 5 solubilized in passive lysis buffer (PLB, Promega, Madison, WI) and luciferase activity measured by a Victor 3 multi-well plate reader (Perkin Elmer, Waltham, MA). The same experimental setup was used for luciferase reporter assays after TCF7 and TCF7L2 gene silencing (day2). Reporter activation values are expressed as relative light units (RLUs).

Boso D., Rampazzo E., Zanon C., Bresolin S., Maule F., Porcù E., Cani A., Della Puppa A., Trentin L., Basso G, & Persano L. (2019). HIF-1α/Wnt signaling-dependent control of gene transcription regulates neuronal differentiation of glioblastoma stem cells. Theranostics, 9(17), 4860-4877.

+ Open protocol

+ Expand

Transposon-Mediated Gene Delivery in HeLa Cells

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

1.5 × 10⁵ HeLa cells were seeded one day prior to transfection. HeLa cells were transfected with 2 μg of the transposon donor plasmid pCMV(CAT)-GFP//T2Neo (52 (link)) and 200 ng of a mutant SB100X transposase, SB100X or a catalytically inactive transposase mutant (E279D, also referred to D3). In the pCMV(CAT)-GFP//T2Neo reporter plasmid a genetically tagged SB transposon disrupts the GFP coding sequence so that cells transfected with this construct do not express GFP. In the presence of SB transposase excision occurs, and in a fraction of the products the GFP coding sequence is restored, thereby leading to green fluorescence that can be quantified, as previously described (55 (link)). Six microliters of TransIT-LT1 transfection reagent (Mirus Bio LLC, Madison, WI USA) were used per transfection reaction. Three days post-transfection cells were trypsinized, washed with PBS, fixed in 1% Paraformaldehyde (PFA) in PBS and FACS analyzed with BD LSR II flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA). Data were analyzed with FCS Express 4 Flow Cytometry (De Novo Software, Glendale, CA). The % GFP positive cells in cultures transfected with SB100X transposase mutants/pCMV(CAT)-GFP//T2Neo were normalized to that in cells transfected with wild-type SB100X/pCMV(CAT)-GFP//T2Neo.

Miskey C., Kesselring L., Querques I., Abrusán G., Barabas O, & Ivics Z. (2022). Engineered Sleeping Beauty transposase redirects transposon integration away from genes. Nucleic Acids Research, 50(5), 2807-2825.

+ Open protocol

+ Expand

Transposition Assay in HeLa Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

For transposition assay in HeLa cells, 2 × 10⁵ cells were seeded onto six-well plates one day prior to transfection. Three μl of TransIT-LT1 transfection reagent (Mirus Bio LLC, Madison, WI, USA) were used to transfect 1 μg of DNA (each transfection reaction was filled up to 1 μg with the plasmid pUC19). To obtain predominantly single-copy transposon insertions (43 (link)), 10 ng of transposon donor plasmid (pT2B/puro) were co-transfected with 5 ng of transposase plasmid (mutant transposase, inactive D3 transposase or SB100X). Forty-eight hours after transfection cells were trypsinized and 2.5-5% of the cells were replated to 10-cm plates, and selected for transposon integration using 3 μg/ml puromycin (InvivoGen, San Diago, CA, USA). After 3 weeks of selection, cell colonies were fixed with 10% (vol/vol) formaldehyde in phosphate-buffered saline (PBS), stained with methylene blue in PBS, and counted. For in vitro comparisons of relative transposition efficiencies at least three independent experiments were performed.

+ Open protocol

+ Expand

Recombinant Mouse HPSE1 Purification

Check if the same lab product or an alternative is used in the 5 most similar protocols

To prepare the mouse recombinant HPSE1, full-length coding sequence of the gene was purchased (OriGene, Rockville, MD, USA) and subcloned into pIRES2-eGFP (Clonetech, Mountain View, CA, USA) by PCR with a FLAG-tag sequence added immediately before the stop codon to generate pHPSE1-FLAG-IRES2-eGFP. The resulted plasmid was transfected into 293T cells with TransIT-LT1 transfection reagent (Mirus Bio, Madison, WI, USA) according to the manufacturer’s instruction. The culture medium was harvested 48 to 72 hr later, reduced volume by concentrators with 10 kDa molecular weight cut-off (GE Healthcare, Pittsburgh, PA, USA) and the recombinant HPSE1 was purified with anti-FLAG M2 magnetic beads (Sigma-Aldrich) according to the manufacturer’s instruction. The buffer of the final eluent was exchanged from 0.1 M Glycine-HCl (pH 3.0) to PBS with concentrators. The resulted preparation was characterized by SDS-PAGE and western blot and the concentration was calibrated by BCA assay (Thermo Scientific).

Cheng C.C., Lee Y.H., Lin S.P., HuangFu W.C, & Liu I.H. (2014). Cell-autonomous heparanase modulates self-renewal and migration in bone marrow-derived mesenchymal stem cells. Journal of Biomedical Science, 21(1), 21.

+ Open protocol

+ Expand

Generating B2M Knockout iPSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Guide RNA (gRNA) GAGTAGCGCGAGCACAGCTA targeting exon 1 of B2M gene was designed with CRISPOR [43 (link)] and cloned into a PX458 plasmid (Addgene #48138). iPSCs were transfected with TransIT^®-LT1 Transfection Reagent (MirusBio) according to the manufacturer’s protocol. On day 2 after transfection, GFP-positive iPSCs were sorted by FACSMelody (BD Biosciences) and 2 × 10⁴ cells were seeded into Matrigel-coated 35 mm culture dishes in Essential 8™ + 10 μM Y27632 medium. On day 12 after transfection, single cell clones of potential B2M KO iPSCs were picked up manually and transferred to a 48-well plate for clonal expansion. On day 17 after transfection, we selected HLA-I negative iPSCs clones, and the lack of B2M and HLA-I expression was confirmed by flow cytometry. On-target genome editing of B2M gene was verified by Sanger sequencing. The fragments spanning the targeted region generated in PCR amplification were cloned into pAL2-T vector using Quick-TA kit (Evrogen). Recombinant plasmids from individual bacterial clones were then sequenced with M13 standard primers. Characterization of iPSCs was performed as described previously [44 (link)] with modest modifications (see Additional file 1).

Bogomiakova M.E., Sekretova E.K., Anufrieva K.S., Khabarova P.O., Kazakova A.N., Bobrovsky P.A., Grigoryeva T.V., Eremeev A.V., Lebedeva O.S., Bogomazova A.N, & Lagarkova M.A. (2023). iPSC-derived cells lack immune tolerance to autologous NK-cells due to imbalance in ligands for activating and inhibitory NK-cell receptors. Stem Cell Research & Therapy, 14, 77.

+ Open protocol

+ Expand

Immunofluorescence Imaging of AKAP220 in Kidney Tissue and mIMCD3 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Wild-type and AKAP220KO mice kidneys were fixed in 10% (vol/vol) buffered formalin (4°C), embedded in paraffin and 4-μm-thick sections collected. Sections were deparaffinized using Citrasolv (Fisher) and antigen retrieved in buffer A using a Retriever 2100 pressure cooker (Electron Microscopy Sciences). Tissue sections were blocked in 10% (vol/vol) donkey serum in PBS solution before overnight incubation with the respective primary antibodies.
Cell culture mIMCD3 cells were maintained in DMEM: F12 1:1 media supplemented with 10% FBS and penicillin/streptomycin. Cells were transfected with plasmids using Mirus TransIT-LT1 transfection reagent and incubated for 48–72 hr before lysis or fixation. All cell lines were maintained in a 5% CO2 incubator at 37°C.
mIMCD3 spheroids mIMCD3 cells were seeded in Matrigel to generate spheroids as previously described (Giles et al., 2014 (link)). The spheroids were stained with Acetyl tubulin for marking primary cilia and those with a visible open lumen were imaged and used in the quantification.

Gopalan J., Omar M.H., Roy A., Cruz N.M., Falcone J., Jones K.N., Forbush K.A., Himmelfarb J., Freedman B.S, & Scott J.D. (2021). Targeting an anchored phosphatase-deacetylase unit restores renal ciliary homeostasis. eLife, 10, e67828.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!