Power syber green master mix

Total RNA was isolated from control-, siRNA-Scrambled-, siRNA-AK3-1- and 2-, siRNA-DDX46-1- and 2-, AK3 1 and 2 siRNA- and DDX46-1 and 2 siRNA-transfected cells using an RNeasy mini kit (Qiagen) according to the manufacturer's instructions. Total RNA quality was analyzed using the Agilent RNA 6000 nano kit. The RNA integrity values obtained for total RNA were 8–10. Complementary DNA was synthesized from 1 μg total RNA using a Verso cDNA synthesis kit (Thermo Scientific). Real-time fluorescent RT-PCR was performed using specific primers for DDX46 (forward GCCCCAAACCAATTAAATCCTG and reverse CAATGCCAATCAAATCTCGTCC) and AK3 (forward TTACTGCTCGCTGGATTCATC and reverse GTCTCTTGATAACCGTCTCTGG) (KiCqStart Primers; Sigma Aldrich) in triplicate, using Power SYBER green master mix (Applied Biosystems, Foster City, CA). The levels of the target genes were normalized relative to β-actin mRNA levels assessed using appropriate primers (forward ACTCTTCCAGCCTTCCTTCC, reverse TGTTGGCGTACAGGTCTTTG). Samples were amplified by a 7300 Real Time PCR System (Applied Biosystems) for 40 cycles using the following PCR parameters: 95°C for 15 seconds, 60°C for 1 minute, and 72°C for 1 minute. Copy numbers for each sample were calculated by the CT-based calibrated standard curve method. The means fold-change (± SEM) of the three replicates were calculated.

Cells were collected by centrifugation, and RNA was extracted using the Trizol/chloroform method (Invitrogen) according to manufacturer’s instructions. The concentration of total RNA was measured by a ND-1000 NanoDrop spectrophotometer and one microgram of RNA was treated with DNAse I (Invitrogen) and used for the reverse transcription using the high capacity cDNA reverse transcription kit (Applied Biosystems). The resulting cDNA was diluted 1:4 and assessed by qRT-PCR using Power Syber Green Master Mix (Applied Biosystems). The volume of each reaction was 25 μL. Measurements were done in a 7500 Real Time PCR system. For each sample, qRT-PCR reactions were done in triplicate, and the entire analysis was done twice independently. Ct-values for each sample and the data were exported to Microsoft Excel for further analysis. The average Ct-value for the endogenous control (GADPH) was calculated for each sample. To calculate the relative expression of the gene of interest the delta-delta Ct-method was used [45 (link)]. The sequence of the primers used is provided in the Additional file 1: Table S1.

F. nucleatum WT and ΩsiaT were grown anaerobically to exponential phase in supplemented Columbia broth at 37°C. RNA was isolated using PureLink RNA isolation kit (Ambion, Austin, TX, USA) according to the manufacturer’s instructions and treated with 2.7 Kunitz units of DNase (Qiagen, Hilden, Germany) per microgram of RNA. cDNA was synthesized using a high-capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific) following the manufacturer’s protocol. Expression analysis at transcript level was done by RT-qPCR using Power SYBER Green master mix (Applied Biosystems, Foster City, CA, USA) with 1 ng of cDNA and 300 nM of each forward and reverse primer (S1 Table) in a final volume of 20 μL. Data were analyzed by the ΔΔCt method [87 (link)]. Expression of target genes was normalized to the relative expression of F. nucleatum-specific 16S rRNA [88 (link)]. Each experiment was performed in triplicate and repeated 3 times.

Total RNA was isolated from si-NT- and from si-hVDAC1-2A-treated tumors (TTs) (from three mice each) using an RNeasy mini kit (Qiagen; Hilden, Germany). Complementary DNA was synthesized from 1 µg total RNA using a Verso cDNA synthesis kit (Thermo Scientific; Walthman, MA, USA). q-RT-PCR was performed as described previously [49 (link)], using specific primers (Table S2, Sigma Aldrich (St. Louis, MO, USA)) in triplicate, with Power SYBER Green Master Mix (Applied Biosystems; Foster City, CA, USA). β-actin mRNA was used to normalize the levels of the target genes. The results are presented as mean fold change (±SEM) of the three replicates.