E coli top10

The CDSs of ldpA and ldpB were amplified by RT-PCR using SuperScript™ III One-Step RT-PCR System with Platinum^® Taq High Fidelity (Life Technologies) and the following gene-specific primers: ldpA-f 5′-CTGAAGCTTATGATGAAGTCCATCCGGTTTCT-3′, ldpA-r, 5′-GTAAGCTTCTAAATACCAACGCAGACATAG-3′, ldpB-f 5′-TGGAAGCTTATGGGACTTACTTCGATTCTTATT-3′ and ldpB-r 5′-GGAAGCTTCTAGAGCAGGATTCTGAGCAGC-3′. The resulting RT-PCR products were cloned into the pCR2.1^TM-TOPO^® vector (Life Technologies) to produce pCR2.1-LdpA and pCR2.1-LdpB, which were used to transform chemically competent E. coli TOP10 (Life Technologies). Plasmid DNA was extracted using the GenElute^TM Plasmid Miniprep kit (Sigma-Aldrich), and correct insertion was confirmed by DNA sequencing.

N. gonorrhoeae strains used in this study are derived from the laboratory strains FA19 and F62 and are described in S4 Table. Gonococcal strains were grown overnight at 37°C under 5% (v/v) CO₂ on GC agar plates containing Kellogg’s supplements I and II [57 (link)]. When indicated glucose in supplement I was replaced by L-lactate or pyruvate at indicated concentrations. Growth in liquid medium was at 37°C with agitation (225 r.p.m.) in GC broth containing Kellogg’s supplements I and II and 0.042% (w/v) sodium bicarbonate. When necessary, culture media were supplemented with ampicillin (Amp; 100 μg/mL), chloramphenicol (Cm; 0.5–1.0 μg/mL), kanamycin (Km; 50 μg/mL), erythromycin (Erm; 1 μg/mL), isopropyl-β-D-thiogalactopyranoside (IPTG; 0.5 to 1.0 mM as indicated) or 5-bromo-4-chloro-3- indolyl-β-D-galactopyranoside (X-gal; 20 μg/mL). E. coli TOP10 (Life Technologies, Carlsbad, CA) and ER2566 (New England BioLabs, NEB) were used for cloning and protein expression purposes respectively and grown on LB medium.

Generation of an N-terminal FLAG-tagged TAK1 construct (TAK1-FLAG) was created using pDONR223-MAPK37 (Addgene) as a PCR template to amplify the TAK1 coding region with Phusion high fidelity polymerase (New England Biolabs). A start codon, Kozak sequence, FLAG tag and restriction sites (XhoI and NotI) were added to the TAK1 sequence using the following primers (5′-TTTTCTCGAGGCCACCATGGATTACAAGGATGACGACGATAAGTCTACAGCCTCTGCCGCCTCC, 3′- TTTTGCGGCCGCTCATGAAGTGCCTTGTCGTTTCTGCTGCTG). The PCR product was digested and ligated with T4 DNA ligase into a CIP-treated pGAW1004 (provided by Dr. Gregory Wasserman, Boston University School of Medicine) vector using restriction sites XhoI and NotI. The expression vector was transformed using E. coli TOP10 (Life Technologies) competent cells and transformants selected on LB plates containing Amp¹⁰⁰. Transformants were screened via restriction analysis and sequencing of isolated plasmid DNA confirmed proper sequence. Overexpression in Hela cells was performed and Western blot analysis confirmed expression with either an anti-FLAG or anti-TAK1 antibody.

All strains used in this study can be found in S2 Table.
Meningococci NEM8013 and N. cinerea were grown at 37°C in a moist atmosphere containing 5% CO2 on GCB (« Gonococcal Broth »; Difco) agar plates containing Kellog's supplements and appropriate antibiotics (100 µg/ml kanamycin, 6 µg/ml chloramphenicol and/or 4.5 µg/ml erythromycin for NEM8013 or 9 µg/ml erythromycin for N. cinerea). E. coli TOP10 (Life technologies) or BL21(DE3) (Life technologies) were grown at 37°C in liquid or solid Luria-Bertani (LB) medium (Difco), which contained appropriate antibiotics (50 µg/ml ticarcillin, 10 µg/ml chloramphenicol and/or 50 µg/ml kanamycin).

For antibody production, pASK-IBA3C-essB was transformed in E. coli TOP10 (Life Technologies) and a single colony used to inoculate an overnight pre-culture. The pre-culture was diluted 1:100 and grown at 37°C to an optical density of OD₆₀₀ = 0.4–0.6. EssB was expressed by adding 2.5 mM anhydrotetracycline (24 h, 18°C). Cells were harvested by centrifugation (6000 xg, 20 min, 4°C) and resuspended in 300 mM NaCl, 50 mM Tris pH 8.0. Cells were lysed by two rounds of French press-mediated lysis (10,000 psi) and the membrane fraction of cleared lysate was collected by ultracentrifugation (185,000 xg, 1 h, 4°C). Membrane proteins were then extracted in 300 mM NaCl, 50 mM Tris pH 8.0, 1% DDM (1 h, 4°C). Insoluble proteins were removed by ultracentrifugation (185,000 xg, 1 h, 4°C). Membrane proteins were loaded on a pre-equilibrated 2x 1 ml StrepTrap HP column (GE Healthcare) and eluted with 2.5 mM desthiobiotin. Peak fractions were concentrated with a 10 kDa concentrator and further purified on an S200 size exclusion chromatography column. For antibody generation, protein was diluted in 1x PBS + 0.05% DDM (final concentration 0.3 mg/ml). Rabbit immunization and antibody production were performed by ImmunoGlobe GmbH (Himmelstadt, Germany).