Q sepharose column

Recombinant α-syn was expressed and purified from the periplasmic fraction as reported.³⁰ (link) Briefly, wild-type human α-syn cDNA was cloned in the pET-28a plasmid (Novagen) and transformed into Escherichia coli BL21 (DE3). Cell cultures (1 L) were grown at 37°C to an OD 600 nm of 0.3–0.4 and the expression was induced with 0.1 mM isopropyl b-d-1-thiogalactopyranoside (IPTG) for 5 h. Cells were collected by centrifugation, re-suspended in 100 ml of osmotic shock buffer (30 mM Tris–HCl pH 7.2, 40% sucrose, 2 mM EDTA) and incubated for 10 min at room temperature. The cells were centrifuged at 12 000 rpm, re-suspended in 90 ml of cold water with 37.5 µl of saturated MgCl₂ solution and, after 5 min incubation on ice, centrifuged again. The supernatant containing the periplasm proteins was boiled for 15 min and cleared by centrifugation. The soluble fraction, enriched in α-syn was subjected to ammonium sulphate precipitation followed by extensively dialysis against 20 mM Tris–HCl, pH 8.0. Further purification of α-syn was performed by anion exchange chromatography loading the sample on a Q-Sepharose column (GE Healthcare) equilibrated with the same buffer and eluted with a 0–500 mM linear gradient of NaCl. The purity of α-syn was checked by SDS–PAGE. The protein was then dialysed against 10 mM Sodium Phosphate buffer pH 7.4, and stored at −80°C until use.

Gene encoding full‐length PF3D7_0512000 (360 bp size; PfPFD‐6) was PCR‐amplified from cDNA using gene‐specific forward (5′ ATGTCTCAAGAAAAAATTAGTGAA 3′) and reverse (5′ TTAAGCTTGTGGAACGGGTAT 3′) primers. PCR‐amplified product was cloned into pGEX4T‐1 and pET28a vector. Full constructs were expressed as C‐terminal hexahistidine‐tagged and GST‐tagged fusion protein in BL21 (DE3) Escherichia coli cells. Affinity purification was carried out for His‐tagged recombinant protein in buffer containing 50 mm Tris/HCl, 300 mm NaCl, and 0.02% Na/azide, pH 8.0. Elutes of affinity chromatography of PfPFD‐6 were subjected to anion exchange chromatography using a Q Sepharose column (GE Healthcare Life Sciences, Chicago, IL, USA). GST‐tagged recombinant protein was purified in 50 mm Tris, 150 mm NaCl, and 0.02% Na/azide pH 8.0 by using glutathione affinity chromatography.

Cell-free extracts were prepared from recombinant M. tuberculosis carrying plasmid pCherry10, diluted 5 fold into 20 mM Tris pH 8.0, 10 mM NaCl and loaded onto a buffer equilibrated Q-sepharose column (GE Healthcare). The column was washed with 10 column volumes of 20 mM Tris pH 8.0, 10 mM NaCl and mCherry protein was eluted using a stepwise increase in salt concentration up to 1 M NaCl. Eluted fractions were concentrated separately using Amicon Ultra Centrifugal Filters 10,000 MWCO (Millipore), coloured fractions pooled, and concentrated to 100 μL. Protein was further purified by applying pooled fractions to a Superdex 75 size-exclusion column (GE Healthcare) and eluting with 20 mM Tris pH 8.0, 10 mM NaCl buffer. Coloured fractions were pooled and concentrated to 25 μM (0.62 mg/mL). Protein was analyzed by LC-ESI-MS by diluting 15 μL of concentrate into 15 μL acetonitrile, 0.1% TFA, loading onto a Polaris 3 C8-A 150x4.6 mm column and eluting with an acetonitrile gradient over 30 min. Mass peaks from multiply charged species were deconvoluted to yield the mass of the mCherry protein. Edman degradation was carried out on 400 pmol of purified protein by Biosynthesis, Inc. on a Procise II Protein Sequencing System (Applied Biosystems).

Core histones were expressed in E. coli BL21 (DE3) RIL cells using ZYM-5052 auto-inducing medium. Histone proteins were found exclusively in inclusion bodies, which were solubilized in unfolding buffer (7 M deionized urea, 20 mM Tris-HCl (pH 7.5), 10 mM DTT). The material was dialyzed against urea chromatography buffer (7 M deionized urea, 10 mM Tris-HCl (pH 7.5), 1 mM EDTA, 100 mM NaCl, 2 mM DTT, 0.2 mM PMSF) and loaded onto a Q Sepharose column in front of a SP Sepharose column (both GE Healthcare, Freiburg Germany). After washing with five column volumes of urea chromatography buffer, the Q Sepahraose column with bound DNA and contaminating proteins was removed. Histone proteins were eluted from the SP Sepharose column using a linear gradient from 0.1 to 0.6 M NaCl. Purified histones were dialyzed extensively against ddH₂O, lyophilized and stored at −80°C.

The DNA fragment encoding Thermosynechococcus elongatus BP-1 Si3 in the β’2 subunit (TelSi3, RpoC2 residues 345–983, 69 kDa) was cloned between the NdeI and BamHI sites of the pET15b expression vector to introduce an N-terminal His₆-tag, and the protein was overexpressed in E. coli BL21(DE3)/pLysS cells. Transformants were subsequently grown in LB media supplemented with ampicillin (100 μg/ml) and chloramphenicol (25 μg/ml) at 37 °C until the OD₆₀₀ reached ~0.5, after which protein expression was induced by adding 0.5 mM IPTG for 10 h at 4 °C. The harvested cells were lysed by sonication, and proteins in the soluble fraction were purified by Ni-affinity column chromatography (HisTrap 5 ml column, GE Healthcare). The His₆-tag was removed by thrombin digestion (1 μg of thrombin per mg of TelSi3 protein) for 20 h at 4 °C, and the protein was further purified by Q Sepharose column chromatography (GE Healthcare) and gel-filtration column chromatography (HiLoad Superdex75 16/60, GE Healthcare). The purified protein was concentrated to 15 mg/ml and exchanged into buffer containing 10 mM Tris-HCl (pH 8.0), 50 mM NaCl and 0.1 mM EDTA.

Both unenriched and ¹⁵N-enriched Yfh1 were expressed in E. coli as described by He et al. [4] (link). Bacteria were grown in minimal medium using ammonium chloride as the sole source of nitrogen. An EDTA tablet was added before cell lysis. Yfh1 purification involved two precipitation steps with (NH₄)₂SO₄, dialysis and then anion exchange chromatography with a GE Healthcare Q-sepharose column using a NaCl gradient. After a dialysis, the protein was further purified by a chromatography with a GE Healthcare Phenyl Sepharose column with a decreasing gradient of (NH₄)₂SO₄. Purity of the recombinant proteins was checked by SDS-PAGE after each step of the purification.