Amplitaq gold pcr master mix

Total RNA was extracted from liver and skin samples with the RNeasy Mini kit (Qiagen, Hilden, Germany), according to the manufacturer’s protocol, and reverse transcribed to cDNA using the iScript Select cDNA synthesis kit (Bio-Rad Laboratories, Hercules, CA, USA). Five microliters of cDNA were used in a nested PCR for HCV RNA detection together with the AmpliTaq Gold PCR master mix (Applied Biosystems, Foster City, CA, USA) and the following primer sets targeting the 5′-untranslated region: sense 5′-GGGGGCGACACTCCACCA-3′ (position 15 to 32) and anti-sense 5′-TCGCGACCCAACACTACTC-3′ (position 256 to 274) for the first round of amplification; and the inner primers sense 5′-GAGTGTCGTGCAGCCTCCAG-3′ (position 98 to 117) and anti-sense 5′-CTCGGCTAGCAGTCTCGCGG-3′ (position 239 to 258) for the second round.
An additional PCR for TSLP mRNA was carried out using 5 μl cDNA, the AmpliTaq Gold PCR master mix (Applied Biosystems), and the QuantiTect human TSLP primer assay (Qiagen). This primer set targets exons 1/2/3 and amplifies a region of 94 base pairs in the two transcripts (2,629 base pairs and 3,834 base pairs, respectively).

Validation of morphologically identified sand fly specimens was done using mitochondrial cytochrome c oxidase gene subunit I (COI) and 18S rRNA genes. Amplification of the COI gene was accomplished using the primers LCO I490 (5′-GGTCAACAAATCATAAAGATATTGG3′) and HCO 2198 (5′TAAACTTCAGGGTGACCAAAAAATCA-3′) [19] . The reaction was carried out in a volume of 15 µl using a pair of primers (1 µM each) and 2× AmpliTaq Gold PCR Master Mix (Applied Biosystems, NJ, USA). After initial denaturation at 95°C for 5 min, amplification was performed with 37 cycles consisting of denaturation at 94°C for 30 sec, annealing at 55°C for 45 sec, extension at 72°C for 1 min 30 sec, followed by a final extension at 72°C for 10 min. For the 18S rRNA locus, the sequence of interest was amplified using the primers Lu. 18S rRNA-1S (5′-TGCCAGTAGTTATATGCTTG-3′) and Lu. 18S rRNA-1R (5′-TTACGCGCCTGCTGCCTTCC-3′) [20] (link). The reaction was carried out in a volume of 15 µl using a pair of primers (0.4 µM each) and 2× AmpliTaq Gold PCR Master Mix (Applied Biosystems, NJ, USA). An initial denaturation was done for 5 min at 95°C, followed by PCR amplification for 30 cycles of denaturation (95°C for 1 min), annealing (55°C for 1 min), and polymerization (72°C for 1 min), with a final extension of 10 min at 72°C. Amplified products were resolved on 2% agarose gels.

The abdomens of all 677 sand flies were subjected to nucleic acid extraction, using a without-boiling Chelex protocol [18 (link)]. Sand fly DNA was amplified using Ins16S_1 primers targeting the 16S rRNA mitochondrial gene (Ins16S_1-F: TRRGACGAGAAGACCCTATA; Ins16S_1-R: TCTTAATCCAACATCGAGGTC), as previously published (216 bp) [11 (link),19 (link)]. PCR amplification was performed in 20-μl mixtures containing 2 μl of 1/10 diluted DNA template, 10 μl of AmpliTaq Gold PCR Master Mix (5U/μl; Applied Biosystems, Foster City, CA, USA), 2 μl of each primer (5 μM) and nuclease-free water (Promega, Madison, WI, USA). The PCR conditions were a first denaturation at 95°C (10 min) followed by 35 cycles of 30 s at 95°C, 30 s at 50°C and 30 s at 72°C and a final elongation step at 72°C for 10 min. When PCR amplification failed, an additional DNA purification was performed with the Qiagen kit (Qiamp DNA mini kit, Hildesheim, Germany), according to the manufacturer’s instructions, and PCR amplification was tried again, resulting in 482 successful PCR amplifications.