Pentr2b

The MtPHO1.1 and MtPHO1.2 genes were amplified from genomic DNA using gene-specific primers (Supplemental Table S3), cloned into the pENTR2B (Invitrogen) by In-Fusion polymerase (Takara Bio), and inserted into pMDC83 plasmid by Gateway cloning (InVitrogen). For transient expression, N. benthamiana plants were infiltrated with Agrobacterium tumefaciens as previously described (Arpat et al., 2012 (link)). Pi and nitrate export assays were performed as previously described (Arpat et al., 2012 (link)). Pi concentration in solution was quantified by the molybdate assay (Ames, 1966 ), whereas nitrate was quantified by first converting nitrate to nitrite using commercial nitrate reductase from Aspergillus niger (Sigma) followed by nitrite quantification using sulfanilamide (Barthes et al., 1995 ). Confocal imaging was performed using a Zeiss LSM 700 instrument with Apochromat 63 × NA1.2 water immersion or multi-immersion objective.

Human Slit1 complementary DNA (cDNA) cloned into the pCR-XL-TOPO vector (Thermo Fisher Scientific, Waltham, MA, USA) was inserted into pENTR2B (Invitrogen, Carlsbad, CA, USA) at the Eco RI site, which was then transferred into the CS2-CMV-RfA-IRES2-Venus lentiviral vector (provided by H. Miyoshi, RIKEN, Wako, Japan) using the Gateway system (Invitrogen). As a Cnt, the same vector into which DsRed cDNA was inserted using the Gateway system or the CS2-CMV-Venus lentiviral vector (provided by H. Miyoshi) was used. For time-lapse imaging, the Slit1 cDNA was inserted into the LeGO-iT lentivirus vector (Addgene plasmid #27361; a gift from B. Fehse) (51 (link)) at the Eco RI site.

MSC isolated from GFP transgenic mice were induced to overexpress SDF‐1 by transduction with a lentivirus encoding SDF‐115. The Lentivirus was constructed using the pLenti6 V5/DEST plasmid Gateway System from the Virapower Lentiviral Expression System (Invitrogen). The SDF‐1 gene was generated by reverse transcription from the mRNA of human foreskin fibroblasts and PCRed using the primers, Forward: 5′‐GCTAGCGTCGACATGAACGCCAAGGTCGTGGTCGTGCTGGTC‐3′; Reverse: 5′‐GAAT TCTTACTTGTTTAAGGCTTTCTCCAGGTACTCCTGAAT‐3′. The resulting product was digested with SalI and EcoRI and ligated it onto a SalI/EcoRI digested shuttle vector, pENTR 2B (Invitrogen, Carlsbad, CA). Following the Gateway System kit instructions, the pENTR2B/hSDF vector was clonased into the pLenti6.2 V5/DEST Vector, creating the pLenti6.2/hSDF‐1 construct, lentiviral particles were produced and cells were transduced. Blasticidin selection was used to isolate a stably transfected cell population. To quantify SDF‐1 overexpression of MSC, 50,000 control and SDF‐1 overexpression MSC (SDF‐1:MSC) were plated separately in T75 flask in serum‐free dulbecco's modification of eagle's medium (DMEM). SDF‐1 levels in the media were quantified using ELISA 24 hours later (R&D Systems, Minneapolis, MN). An equal cell number was verified by quantifying total protein per cell layer at the end of the experiment.