Total RNA from tissues or cells was extracted with TRIzol Reagent (Invitrogen, United States) based on the manufacturer's protocol. RNA from the nuclei and cytoplasm of cell lines was extracted using a Nuclear/Cytosol Fractionation Kit (BioVision, United States). For RNase R digestion, 5 μg of total RNA was incubated for 10 min at 37°C in the presence or absence of 4 U/μg RNase R (Geneseed Biotech, Guangzhou, China). To quantify circRNA, mRNA and miRNA, RT-qPCR samples were prepared with GoTap qPCR Master Mix (Promega, United States) and run on a 7500 Fast Real-time PCR System (Applied Biosystem, Foster City, CA). GAPDH and U6 were used as the internal reference genes, and the relative expression was calculated using the 2-△△Ct method. The PCR primers used are listed in Table S10 .
Gotap qpcr master mix
Manufactured by Promega
Sourced in United States
GoTap qPCR Master Mix is a reagent designed for quantitative real-time PCR (qPCR) applications. It contains the necessary components, including a DNA polymerase, buffers, and dNTPs, to facilitate the amplification and detection of DNA targets.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Transcriptor first strand cdna synthesis kit, by Roche (4 mentions)
Eastep super total rna extraction kit, by Promega (2 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions)
Nuclear cytosol fractionation kit, by Abcam (1 mentions)
7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Rnase r, by Geneseed (1 mentions)
Quantstudio 5 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Goscript reverse transcription system, by Promega (1 mentions)
Primescript rt master mix, by Takara Bio (1 mentions)
Biometra toptical thermocycler, by Analytik Jena (1 mentions)
Rr047a, by Takara Bio (1 mentions)
Trypsin edta, by Thermo Fisher Scientific (1 mentions)
Rpmi 1640 culture medium, by Thermo Fisher Scientific (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Formaldehyde solution, by Merck Group (1 mentions)
Mouse tslp elisa kit, by R&D Systems (1 mentions)
M xylene, by Merck Group (1 mentions)
1 2 4 trimethylbenzene, by Merck Group (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
13 protocols using gotap qpcr master mix
1
Comprehensive RNA Extraction and Analysis
2
Total RNA Extraction and qRT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Eastep®Super Total RNA Extraction kit (Promega, Madison, WI, USA) was applied for isolating total RNA from related cells. cDNA synthesis applying the Transcriptor First Strand cDNA Synthesis kit (Roche, Basel, Switzerland) was completed. qRT-qPCR employing GoTap®qPCRMaster Mix (Promega) was carried out under CFX96™ Real-Time PCR Detection Systems. 2−ΔΔCt method was used for the estimation of the relative expression levels of object genes. 3 times tested specimen was required. The primer sequences were listed: LINC01158 F-primer, 5′-AATCACTGCAATTGAAGGAAAAA-3′ and R-primer, 5′-CCTTGTTTTCCAACCCTTAGACT-3′; CENPK F-primer, 5′-AATGTTGCCTACGTGACCCG-3′ and R-primer, 5′-TCCCCACCGTCACAAAAACA-3′; GAPDH F-primer, 5′-GGGAGCCAAAAGGGTCAT-3′, and R-primer, 5′-GAGTCCTTCCACGATACCAA-3’.
3
Total RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells and tissues using Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. The GoScriptTM Reverse Transcription System (Promega, Madison, WI, USA) and random primers were used for reverse transcription. GoTap® qPCR Master Mix (Promega) was used for real‐time PCR in a QuantStudio5 Real‐time PCR System (Applied Biosystems, Foster City, CA, USA). All primer sequences used in this study are shown in Table S3 , Supporting Information.
4
Quantitative Transcriptional Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with TRIzol reagent following the manufacturer's instructions (Invitrogen, Carlsbad, CA). Total RNA (1 µg) was reversely transcribed into cDNA using PrimeScript RT Master Mix (Takara Bio., Shiga, Japan). qPCR reactions were performed with GoTap qPCR Master Mix (Promega, Madison, WI) using a Biometra Toptical Thermocycler (Analytik Jena, Goettingen, Germany) as previously described.[56 ] Data were normalized to a housekeeping gene (mouse β‐actin or human GAPDH). Primers are listed in Table S2 , Supporting Information.
5
Skeletal Muscle Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from homogenized gastrocnemius using Trizol reagent (Invitrogen, Thermo, Waltham, MA, USA), and reverse-transcribed to cDNA using a reverse transcription kit (RR047A, Takara, Kusatsu, Japan). Quantitative real-time PCR (qRT-PCR) was performed to determine the expression of CD68, CD163, myogenic differentiation (MyoD), myogenin, angiopoietin-1 (Ang-1), and nerve growth factor (NGF) in gastrocnemius muscles using GoTap qPCR Master Mix (A6001/2, Promega, Madison, WI, USA) according to the manufacturer’s protocol. The ribosome gene 36B4 was used as an endogenous control gene to normalize the expression of target genes. Primers used in the analysis are listed in Table 1 . The PCR program comprised of an initial denaturation for 2 min at 95 °C, followed by 40 cycles of 95 °C or 15 s, 60 °C for 1 min and a final extension at 72 °C for 60 s. Relative gene expression was calculated using the 2−∆∆Ct method.
6
Comprehensive RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the tissues and cells using the the Eastep®Super Total RNA Extraction kit (Promega, Madison, WI, USA), and the RNA integrity was evaluated by 1% agarose gel electrophoresis (containing DEPC; Bio-Rad Laboratories, Inc., Hercules, CA, USA). cDNA was synthesized using the Transcriptor First Strand cDNA Synthesis kit (Roche, Basel, Switzerland) following the manufacturer’s protocol. RT-qPCR was performed with GoTap®qPCRMaster Mix (Promega) according to the manufacturer’s instructions using CFX96™ Real-Time PCR Detection Systems. The reaction conditions were as follows (two-step method): One cycle of pre-denaturation for 2 min at 95°C, followed by 40 cycles of 15 sec at 95°C for denaturation, and for annealing to extension, selecting the most suitable annealing temperature according to different primers for 60 sec. The relative expression levels were estimated with the 2-ΔΔCq method. Each specimen was tested 3 times. The specific primer sequences are listed in Table SII .
7
Murine Keratinocyte Cell Line Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The murine keratinocyte cell line PAM212, which was derived from BALB/c mouse skin, was kindly bestowed by Dr. Yuspa (National Institutes of Health, NCI, USA).
Main reagents: RPMI-1640 culture medium (Gibco, 11875093), FBS (Gibco, 12483020), 0.25% trypsin-EDTA (Gibco, 25200114), m-xylene (sigma, 95670), 1,2,4-trimethylbenzene (sigma, 45996), formaldehyde solution (sigma, 252549), TPA (sigma, P1585), PM2.5 (bestowed by the Department of Environmental Health, School of Public Health, Fudan University), mouse TSLP ELISA kit (R&D, MTLP00), reverse transcription kit PrimeScriptTM (Takara, RR037A), and GoTap qPCR master mix (promega, A6002).
Main reagents: RPMI-1640 culture medium (Gibco, 11875093), FBS (Gibco, 12483020), 0.25% trypsin-EDTA (Gibco, 25200114), m-xylene (sigma, 95670), 1,2,4-trimethylbenzene (sigma, 45996), formaldehyde solution (sigma, 252549), TPA (sigma, P1585), PM2.5 (bestowed by the Department of Environmental Health, School of Public Health, Fudan University), mouse TSLP ELISA kit (R&D, MTLP00), reverse transcription kit PrimeScriptTM (Takara, RR037A), and GoTap qPCR master mix (promega, A6002).
8
Quantitative gene expression analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using the RNeasy mini kit (Qiagen) according to the manual without further modifications. RNA purity and quantity were assessed with NanoDrop 100 spectrophotometer (Thermo Scientific, Inc.). cDNA was synthesized with the Verso cDNA Synthesis kit (Thermo Scientific, Inc.) following the protocol described by the manufacturer. For qPCR, GoTap® qPCR Master Mix (Promega) was utilized to set up the reactions as suggested by the manufacturer. The sequences of the primers are: GAPDH (upstream GCACCGTCAAGGCTGAGAAC and downstream TGGTGAAGACGCCAGTGGA); HIF1A (upstream TCAAAGTCGGACAGCCTCAC and downstream ATCCATTGATTGCCCCAGCA); VEGFA (upstream TTGCAGATGTGACAAGCCGA and downstream GGCCGCGGTGTGTCTA).
9
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol kit (Invitrogen) following the instructions of the manufacturer. cDNA was generated by Transcriptor First Strand cDNA Synthesis Kit. GoTap®qPCRMaster Mix (Promega) was used to perform RT-PCR. GAPDH and U6 were employed as endogenous controls by using the 2−ΔΔCt method.
10
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The TRIzol reagent (Solarbio, Beijing, China) was used to extract RNA from tissues and cells. The cDNA was synthesized using the Transcriptor First Strand cDNA Synthesis Kit (Roche, Basel, Switzerland). GoTap®qPCR Master Mix (Promega, Madison, WI, USA) was used to perform the quantitative real time PCR in the StepOne plus Real-Time PCR System (Applied Biosystems). The relative expression levels of mRNA and lncRNA were normalized to GAPDH as endogenous control respectively by using the 2−△△Ct method. Primer sequences were listed in Supplementary Table S1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!