Pfuultra 2 hotstart pcr master mix

Rat DOR cDNA was amplified from the pUC17-rDOR plasmid (Versaclone cDNA NP_036749, R&D systems) using the following forward (5′-CTTCGATATCTTGGAGCCGGTGCCTTCTG-3′) and a standard M13 reverse primer using the Pfu Ultra II Hotstart PCR Mastermix (Agilent, Santa Clara, CA, USA) according to the manufacturer’s protocol. The amplified rDOR PCR product and the pSNAP-hDOR plasmid (Cis-Bio) were restricted using EcoRV and XhoI restriction enzymes (New England BioLabs, Ipswich, MA, USA), and the rDOR construct was exchanged with the hDOR gene followed by ligation with T4 DNA Ligase (New England BioLabs) and transformation into NEB5α competent cells (New England BioLabs). The SNAP-rDOR was fully sequenced to ensure correct orientation and absence of point mutations introduced during amplification.

Oligonucleotide primers for cloning and mutagenesis were ordered from Sigma-Aldrich. For amplification of the gene inserts, PfuUltra II HotStart PCR master mix was used, purchased from Agilent Technologies. Other chemicals were purchased from Sigma-Aldrich and Acros Organics. Precast native PAGE gradient gels were ordered from Bio-Rad. CAL-A lipase was ordered from c-LEcta. As host strain for recombinant DNA, Escherichia coli NEB® 10-beta (New England Biolabs) was used. Precultures were grown in lysogeny broth (LB), and the subsequent main cultures in terrific broth (TB).

Human RGS7 cDNA (NM_001282778) was cloned from HEK293T cDNA using PfuUltra II Hotstart PCR Master Mix (Agilent Technologies, Santa Clara, CA) according to manufacturers’ instructions, using the following forward and reverse primers: tgaccaggatccgccaccatggcccaggggaataattatgggcagaccagc, ggtcagcggccgctcacttatcgtcgtcatccttgtaatctaacaggttagtgctggccc. A FLAG tag was introduced onto the C-terminus of RGS7 during the cloning procedure. PCR products were cloned into the pCDF1-MCS2-EF1-Puro vector via the BamHI and NotI restriction sites. The p.R44C mutation was introduced using fusion PCR site-directed mutagenesis, using the following forward and reverse primers: ggaattcctatttgtacggtcaaaagc, gcttttgaccgtacaaataggaattcc. The p.E383K was introduced into the wild-type using Q5 polymerase (NEB), phosphorylating the PCR product using PNK (NEB) and self ligating it using Quick Ligase (NEB). Primer pairs were: gaaaatatggcaagagtttctgg, ctgaactcttgagggtacttctttaata. The p.V56C, point mutation was introduced into the p.R44C by synthesizing the full vector using Q5 polymerase (NEB), phosphorylating the PCR product using PNK (NEB) and self ligating it using Quick Ligase (NEB). Primer pairs were: GCTTCTCTGGTTCAGACATTGTT, AGCTAGGTATCTTGGAAAGAAAGC.

For all the experiments, the His6x-SUMO-HMFO fusion has been used as it has been demonstrated before that the SUMO protein fused at the N-terminus does not affect the activity nor the thermostability of HMFO [8 (link)]. The gene single point variants, the double mutant I73V H74Y, the 8AxHMFO, and the 8BxHMFO were obtained from pET SUMO-HMFO or pBAD SUMO-7xHMFO by whole-plasmid PCR with PfuUltra II Hotstart PCR Master Mix (Agilent). Template DNA was cleaved with DpnI (New England Biolabs) for at least 2 h at 37 °C. Escherichia coli NEB 10β (New England Biolabs) chemically competent cells were transformed (heat shock at 41 °C for 45 s) and cells plated on 50 μg mL⁻¹ kanamycin or 100 μg mL⁻¹ ampicillin LB agar plates. All mutations were confirmed by sequencing.

The DNA fragments encoding the RIAD, RIAD–RIAD, and RIDD tags were designed using online software (Benchling, San Fransisco, CA, United States). Recognition sites for the restriction enzyme BsaI (GGTCTCN) at the beginning and (NGAGACC) at the end of the coding sequences were introduced to allow Golden Gate cloning. Detailed information of the designed gene sequences is in the Supplementary Information. The plasmid used for amplification of the PTDH- and PAMO-encoding genes was the pBAD-based pCRE2-PAMO [23 (link)]. BsaI restriction sites already present in the PAMO sequence were mutated using PfuUltra II Hotstart PCR Master Mix (Agilent, Santa Clara, CA, United States) to avoid unwanted restriction activity, but maintaining the same translated amino acid. The PTDH and PAMO genes were amplified using the primers reported in Supplementary Information. Fusions of synthetic DNA encoding the RIAD, RIAD–RIAD, and RIDD tags to the C-termini of PTDH and PAMO were obtained by inserting the linker GGGGS in between. The six new fusions constructs were obtained through Golden Gate cloning using a pBAD vector with a 6× His-tag positioned at the N-terminus. The correct sequences were confirmed by sequencing. The recombinant enzymes produced are named as PAMO_A, PAMO_A2 PAMO_I, PTDH_A, PTDH_A2, PTDH_I (where A indicates the presence of an RIAD tag, and I indicates the presence of the RIDD tag).