Brilliant 2 sybr green pcr master mix

Total RNAs were extracted from cells by TRIzol reagent (Life Technologies) according to the manufacturer's protocol. DNA carryovers were digested by incubation of the total RNAs with DNase I (New England Biolabs, Ipswich, MA) for 30 min at 37°C, and the enzyme was inactivated by incubation at 75°C for 10 min. RNA concentration was determined by NanoDrop (Thermo Scientific, Waltham, MA). A 1-μg amount of total RNA was subject to a reverse transcription using Affinity Script reverse transcriptase (Agilent Technologies, Santa Clara, CA) with oligo d(T) primer according to the manufacturer's protocol. Endogenous rMunc13-4 cDNA was amplified by Brilliant II SYBR Green PCR Master Mix (Agilent Technologies) using forward primer ATCGATGCCAAGGGGTCGA and reverse primer GTCAGTCCAGGTACCCTGCAG, and the amount of amplification was monitored by ABI7500 Fast System (Life Technologies). As a reference gene, rat β-actin cDNA was amplified and detected by the same method using forward primer AGGCCAACCGTGAAAAGATG and reverse primer GGTACGACCAGAGGCATACA. Cycle threshold was determined for rMunc13-4 and β-actin from the amplification curves acquired by 7500 Software (Life Technologies). Relative expression was calculated by the E^ΔΔCt method using Ct values of parental RBL cell samples as controls (Pfaffl, 2001 (link)).