Nucleospin plant kit

Quantitative PCR (qPCR) with PMA was performed to assess membrane integrity after irradiation exposure. One mille liter of fungal colonies at concentration of 20,000 CFU/ml were divided in two identical aliquots of 500 μl. Only one aliquot was treated with PMA as following: a solution of 5 μl of PMA (20 mM concentration, Biotium, Hayward, CA, United States) was added the samples. Both aliquots (treated with PMA and non-treated) were kept in the dark in a constant-shaking incubator for 1 h. PMA solution penetrates only cells with damaged cell-membranes and crosslinks the DNA preventing PCR after being exposed to light (Onofri et al., 2012 (link)). DNA extraction was performed using NucleoSpin® Plant kit (Macherey-Nagel, Düren, Germany) following the protocol optimized for fungi Selbmann et al. (2011) (link). The extracted DNA was quantified using the Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific, Massachusetts, United States) and normalized at the same concentration of 0.1 ng/ml. qPCR assay was performed to quantify the number of fungal Internal Transcribed Spacer (ITS) ribosomal DNA fragments (281 bp) present in treated and non-treated samples. A detailed protocol is provided by Onofri et al. (2012) (link). All tests were performed in triplicate.

A NucleoSpin Plant Kit (Macherey-Nagel, Düren, Germany) was used to extract DNA from the dried liverwort tissue. The primers suggested by White et al. [12 ] for ITS1-2 and Taberlet et al. [13 (link)] for trnL-F were implemented for amplification and sequencing.
PCR was carried out in 20 µl volumes with the following procedure: 3 min at 94 °C, 30 cycles (30 s 94 °C, 40 s 56 °C, and 60 s 72 °C), and 2 min for the final extension time at 72 °C. Amplified fragments were visualized on 1% agarose TAE gels by EthBr staining and then purified with GFX PCR DNA and Gel Band Purification Kits (Amersham Biosciences, Chicago, IL, USA). The sequencing reactions were performed with the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Waltham, MA, USA) following the standard protocol provided for the 3730 DNA Analyzer (Applied Biosystems, Waltham, MA, USA) at the Genome Center of EIMB (Moscow, Russia).

DNA was extracted from every organ sampled from the infected plant material and investigated by microscopy using the NucleoSpin®Plant kit (Macherey-Nagel, Düren, Germany). DNA was extracted according to the protocol supplied by the manufacturer.
DNA from P. viticola sporangia was prepared based on a slight modification of the protocol of Pintye et al. (2012 (link)). Frozen spores were crushed with a sterile conical grinder in 150 μl of extraction buffer. The resulting suspension was kept at −20°C for 10 min and was then shifted to 70°C for further 10 min. After cooling down on ice for 5 min, it was centrifuged for 10 min at 12,000 g and room temperature. All further extraction steps followed the protocol. Final elution was in 50 μl of TE buffer (10 mM Tris-Cl, 1 mM EDTA, pH 8.0). All DNA samples were stored frozen at −20°C.

In the laboratory, sample cups were gently shaken to suspend cells in a homogeneous solution before a subsample (10 mL) was taken. Large swimmers were removed using a 1-mm mesh nylon sieve. The subsample from every cup was filtered through a 3 µm pore size polycarbonate filter using a <50 mmHg vacuum. The filtrate was then collected onto a 0.2 μm Millipore Isopore membrane filter (Millipore, Schwalbach, Germany). Filters were washed with sterile Kara Sea water (~50 mL) as recommended by Metfies et al. [19 (link)]. Total DNA from the filters and from the Sterivex unit was extracted with a NucleoSpin Plant Kit (Macherey-Nagel, Düren, Germany) following the manufacturer’s instructions.
A subsequent analysis of DNA was carried out according to Belevich et al. [28 (link)]. A fragment of the 18S rDNA containing the hypervariable V4 region was amplified with the primers EuF-V4(f) (5′-CCAGCASCCGCGGTAATWCC-3′) and picoR2(r) (5′-AKCCCCYAACTTTCGTTCTTGAT-3′) [32 (link)]. The library preparation and sequencing of the DNA fragments were carried out with TruSeq Nano DNA Kit according to the manufacturer’s protocol by using the Illumina MiSeq system (Illumina, San Diego, CA, USA). The read length was 250 bp; reading was performed from both sides of the fragments. The sequencing was conducted by BioSpark (Moscow, Russia).

DNA extraction was performed on dried colonies using NucleoSpin^® Plant kit (Macherey-Nagel, Düren, Germany) following the protocol optimized for fungi [20 (link)]. Quantitation of extracted genomic DNA was performed using Qubit system and all the samples were diluted to the same concentration (2 ng/mL). Three overlapping tracts in the internal transcribed spacer (ITS) regions and the large subunit-coding sequences (LSU) of the nuclear ribosomal RNA (rRNA) gene complex were amplified. The used primers were ITS4a (ATTTGAGCTGTTGCCGCTTCA), ITS5 (GGAAGTAAAAGTCGTAACAAGG), LR5 (TCCTGAGGGAAACTTC) and LR7 (TACTACCACCAAGATCT). PCR reactions were carried out for each sample in a solution consisting of 12.5 μL of BioMixTM (BioLine Ltd., London, UK), 1 μL of each primer solution (5 pmol/μL) and 0.2 ng of DNA template, in a final volume of 25 μL. MyCycler Thermal Cycler (Bio-Rad Laboratories GmbH, Munich, Germany) equipped with a heated lid was used and amplification conditions are as reported in [21 (link)]. The whole genome integrity was assessed by random amplified polymorphic DNA (RAPD). PCR reactions were carried out for each sample in a final solution containing 12.5 μL of BioMixTM, 5 pmol of primer (GGA)₇ and 0.2 ng of DNA sample, in a final volume of 25 μL. Amplifications were performed according to [21 (link)].

Total genomic DNA was extracted from leaf tissue using the NucleoSpin Plant-Kit (Macherey-Nagel, Düren, Germany) following the manufacturer’s instructions. Three plastid and one nuclear marker were amplified (Table 1). Amplification of the target loci was conducted in a Mastercycler (Eppendorf, Hamburg, Germany). Each 20 μl volume contains 2.00 μl 10× PCR buffer (without MgCl₂), 1.00 μl DMSO, 0.20 μl 100 mM dNTPs, 1.4 μl 50 mM MgCl₂, 0.20 μl 0.05 mM each forward and reverse primers, 0.20 μl Taq DNA polymerase (BioTherm DNA polymerase 5 u/μl from GeneCraft, Lüdinghausen, Germany), 1 to 2 μl genomic DNA extract and filled up with H2O. Amplification cycles were as follows: one cycle of 3 min at 94°C, 35 cycles of 30 s at 94°C, 30 s at 50°C, 1.5 min at 72°C with a final extension period of 10 min at 72°C. PCR products were sequenced by LGC Genomics (Berlin, Germany). Sequences were edited and then aligned manually (after preliminary automatic alignment in MUSCLE [28 (link)]) with the program Geneious 4.8.3 (http://www.geneious.com [29 (link)]) dx.doi.org/10.17504/protocols.io.taneide.[PROTOCOL DOI]