Log In Sign up
The largest database of trusted experimental protocols

Hr dna repair template

Manufactured by TriLink
Visit Supplier

HR DNA repair template is a laboratory product designed for DNA repair research. It functions as a template for homologous recombination (HR) repair, a process essential for maintaining genomic integrity. The template can be utilized in various experimental setups requiring HR-mediated DNA repair.

Automatically generated - may contain errors

Lab products found in correlation

Guide rna, by Synthego (2 mentions) Homologous recombination dna repair template, by Integrated DNA Technologies (2 mentions) Cas9 mrna, by TriLink (2 mentions)

2 protocols using hr dna repair template

1

CRISPR-Cas9 Flag-Knockin Mice Generation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Flag-knockin mice were generated using CRISPR-Cas9-mediated genome editing. Guide RNA was designed and ordered from Synthego (Redwood City, California, USA), guide for flag-knockin mice (5´ ACGTTTGGCACTAAGCTCTT AGG 3´). Homologous recombination (HR) DNA repair template was ordered from Integrated DNA Technologies (IDT, Coralville, Iowa, USA), template for flag-knockin mice (5´TCTGCATGTGGTTTTTATGGGGTTTTCCTTCATCGTTCTTTGTGAATCTCCTAAGAGCTGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACGATGACAAGGCTTAGTGCCAAACGTATCCTAGGGAAACAGGTAGCTTGTTTTCTAAAAAGCTTGAGTAGAAA3´). Embryo microinjection into FVBxB62J F1 hybrid zygotes was performed as previously described27 (link), using 50 ng/ul of sgRNA, 25 ng/ul of HR DNA repair template, 50 ng/ul of Cas9 mRNA (TriLink Biotechnologies) and 50 ng/ul of Cas9 HiFi protein (IDT). We genotyped the flag-knockin mice using the primer sets, loci12F430, 5´GTCAGTGCTCACTTGGGATATG3´, and Flag_Rev, 5ĆCTTGTCATCGTCATCCTTGTA3´, which yield a 390bp amplicon.
Sun Y.H., Zhu J., Xie L.H., Li Z., Meduri R., Zhu X., Song C., Chen C., Ricci E.P., Weng Z, & Li X.Z. (2020). Ribosomes guide pachytene piRNA formation on long intergenic piRNA precursors. Nature cell biology, 22(2), 200-212.
+ Open protocol
+ Expand
2

CRISPR-Cas9 Flag-Knockin Mice Generation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Flag-knockin mice were generated using CRISPR-Cas9-mediated genome editing. Guide RNA was designed and ordered from Synthego (Redwood City, California, USA), guide for flag-knockin mice (5´ ACGTTTGGCACTAAGCTCTT AGG 3´). Homologous recombination (HR) DNA repair template was ordered from Integrated DNA Technologies (IDT, Coralville, Iowa, USA), template for flag-knockin mice (5´TCTGCATGTGGTTTTTATGGGGTTTTCCTTCATCGTTCTTTGTGAATCTCCTAAGAGCTGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACGATGACAAGGCTTAGTGCCAAACGTATCCTAGGGAAACAGGTAGCTTGTTTTCTAAAAAGCTTGAGTAGAAA3´). Embryo microinjection into FVBxB62J F1 hybrid zygotes was performed as previously described27 (link), using 50 ng/ul of sgRNA, 25 ng/ul of HR DNA repair template, 50 ng/ul of Cas9 mRNA (TriLink Biotechnologies) and 50 ng/ul of Cas9 HiFi protein (IDT). We genotyped the flag-knockin mice using the primer sets, loci12F430, 5´GTCAGTGCTCACTTGGGATATG3´, and Flag_Rev, 5ĆCTTGTCATCGTCATCCTTGTA3´, which yield a 390bp amplicon.
Sun Y.H., Zhu J., Xie L.H., Li Z., Meduri R., Zhu X., Song C., Chen C., Ricci E.P., Weng Z, & Li X.Z. (2020). Ribosomes guide pachytene piRNA formation on long intergenic piRNA precursors. Nature cell biology, 22(2), 200-212.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!