Gs flx platform

Manufactured by Roche

Sourced in United States

The GS FLX platform is a DNA sequencing instrument developed by Roche. It utilizes pyrosequencing technology to perform high-throughput DNA sequencing. The GS FLX platform is designed to generate large amounts of sequence data for a variety of applications, such as genome sequencing, transcriptome analysis, and metagenomics.

Automatically generated - may contain errors

Lab products found in correlation

Qiaamp dna mini kit, by Qiagen (1 mentions) Cdna rapid library preparation kit, by Roche (1 mentions) Ribominus eukaryote kit, by Thermo Fisher Scientific (1 mentions) Repli g midi kit, by Qiagen (1 mentions) Wizard genomic dna purification kit, by Promega (1 mentions)

Close spelling variants of this product

Roche 454 GS FLX+ Titanium platform (44 citations) GS FLX (29 citations) 454 GS FLX platform (25 citations) GS-FLX Titanium platform (16 citations) Roche 454 GS FLX sequencing platform (5 citations) GS FLX Titanium sequencing platform (5 citations) Roche Genome Sequencer GS-FLX Titanium platform (3 citations) GS FLX/454 pyrosequencing platform (2 citations) GS FLX+ sequencing platform (2 citations) 454 Life Sciences GS FLX Titanium platform (2 citations)

11 protocols using gs flx platform

Sequencing and Analysis of 16S rRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA extraction and PCR amplification of the V5–V6 region of 16S rRNA genes were performed as described in Supplementary Information and previous studies (Dethlefsen and Relman, 2011 (link), Lee et al., 2011 (link)). PCR products from different samples were mixed at equal ratios for pyrosequencing with the GS FLX platform (Roche, Branford, CT, USA; University of Hawaii, Honolulu, HI, USA) and a total of 13 runs were performed for the 314 samples. Samples from at least three ethnic groups were blended in each run, to ensure that there was no case that samples from one single ethnic group were sequenced in a single run (Supplementary Table S2).
Operational taxonomic unit (OTU) classification, chimera removal, tree construction and taxonomic assignment were all performed using the QIIME package (Quantitative Insights Into Microbial Ecology, Boulder, CO, USA, v1.2.1) (Caporaso et al., 2010 (link)) after removing the bad-quality sequences from the raw data set (Supplementary Information). To minimize the difference of sequencing depth among samples, the rarefied OTU subset was generated by averaging 1000 evenly resampled OTU subsets for further alpha and beta diversity analysis (Supplementary Information).

Zhang J., Guo Z., Xue Z., Sun Z., Zhang M., Wang L., Wang G., Wang F., Xu J., Cao H., Xu H., Lv Q., Zhong Z., Chen Y., Qimuge S., Menghe B., Zheng Y., Zhao L., Chen W, & Zhang H. (2015). A phylo-functional core of gut microbiota in healthy young Chinese cohorts across lifestyles, geography and ethnicities. The ISME Journal, 9(9), 1979-1990.

+ Open protocol

+ Expand

16S rRNA Gene Amplification and Pyrosequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

The pellets were used for DNA extraction. DNA was extracted as previously described^{17 (link), 18 (link)}. Purification, amplification, and pyrosequencing were conducted following the procedure of Zhang et al.^{18 (link)}. Briefly, extracted DNA was purified using a QIAamp DNA mini kit (QIAGEN, Germany), and the V1–V3 region of the 16 S rRNA gene was amplified by PCR. The primers were 5′-CGTATCGCCTCCCTCGCGCCATCAGACGAGTGCGTAGAGTTTGATYMTGGCTCAG-3′ and 5′-CTATGCGCCTTGCCAGCCCGCTCAGNNNNNNNNNNATTACCGCGGCTGCTGG-3′ with a sample-unique 10-mer oligonucleotide barcode. Equal amount of the PCR products for each sample were mixed and subjected to pyrosequencing using the GS FLX platform (Roche, Branford, CT, USA).

Chen T., Long W., Zhang C., Liu S., Zhao L, & Hamaker B.R. (2017). Fiber-utilizing capacity varies in Prevotella- versus Bacteroides-dominated gut microbiota. Scientific Reports, 7, 2594.

+ Open protocol

+ Expand

Rhizosphere Bacterial Community Profiling via Pyrosequencing

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Pyrosequencing was performed to characterize the rhizosphere bacterial community. Bacterial 16S rRNA genes were initially PCR-amplified with the 799F and 1525R primer set (chosen because it does not amplify Brachypodium plant-derived sequences) as described above, and the purified amplicons were amplified and sequenced on a Roche GS FLX+ platform using the 799F and 1394R (ACGGGCGGTGTGTRC) [45 (link)] primer set (Experiment 1) or 799F and 1193R (ACGCATCCCCACCTTCCTC) [29 (link)] primer set (Experiment 2) by Molecular Research LP (Shallowater, TX, USA).
Sequences were analyzed using MOTHUR v.1.32.0, following the protocol of Schloss et al. [46 (link)] (http://www.mothur.org/wiki/454_SOP, website accessed on July 2015). Short and low quality sequences were removed, and remaining sequences were aligned with the SILVA database (release 119) [47 (link)]. Unaligned sequences and chimeras were removed, and the valid sequences were clustered into OTUs (Operational Taxonomic Units) at 97% similarity. Sequences were then randomly subsampled from each sample (1015 sequences for Experiment 1 and 3534 sequences for Experiment 2) to achieve an even sequencing depth, and the taxonomy was assigned to OTUs by comparing to the RDP trainset ver. 14 [48 (link)].

Kawasaki A., Donn S., Ryan P.R., Mathesius U., Devilla R., Jones A, & Watt M. (2016). Microbiome and Exudates of the Root and Rhizosphere of Brachypodium distachyon, a Model for Wheat. PLoS ONE, 11(10), e0164533.

+ Open protocol

+ Expand

Gut Microbiome Profiling in Gout Patients

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The datasets of gut microbiome we reanalyzed in this study were first reported by Guo et al.^{15 (link)} The stool samples were collected from 83 Chinese adults, including 41 gout patients and 42 healthy individuals. The collected stool samples were pyro-sequenced on Roche GS FLX platform to obtain 535 153 high-quality 16S-rRNA reads by amplifying the V1-V3 region. The 16S-rRNA reads were fed into the bioinformatics pipeline (QIIME V1.5), and a total of 3689 OTUs at 97% similarity level, and their abundances in the form of OTU (operational taxonomic unit) tables were obtained. Detailed information on the datasets is referred to Guo et al.^{15 (link)}

Zhou J., Yuan Y., Xu P., Yi B., Chen H, & Su W. (2022). Host-Population Microbial Diversity Scaling of Chinese Gut Microbiomes in Gout Patients. Evolutionary Bioinformatics Online, 18, 11769343221095858.

+ Open protocol

+ Expand

Fosmid Sequencing and Analysis of SMG 9

Check if the same lab product or an alternative is used in the 5 most similar protocols

Fosmid DNA was isolated from SMG 9 as described above to a concentration >200 ng/μl (approximately 5 μg in total). Sequencing of the full fosmid insert of SMG 9 was performed by GATC Biotech (Konstanz, Germany) using 454-pyrosequencing on a titanium mini-run of the Roche GS-FLX platform, achieving approximately 65-fold coverage. Sequencing reads were assembled into a single contig by GATC Biotech. The retrieved sequence was analyzed using the FGENESB software program (Softberry) to identify putative open reading frames and translated nucleotide sequences were subjected to BLASTP analysis to assign putative functions to the encoded proteins and identify homologous sequences from the National Centre for Biotechnology Information (NCBI; http://www.ncbi.nlm.nih.gov/blast/Blast.cgi). The full fosmid insert sequence of SMG 9 was submitted to GenBank and assigned the following accession number; KJ524644.

Culligan E.P., Marchesi J.R., Hill C, & Sleator R.D. (2014). Combined metagenomic and phenomic approaches identify a novel salt tolerance gene from the human gut microbiome. Frontiers in Microbiology, 5, 189.

+ Open protocol

+ Expand

Bacterial 16S rRNA Gene Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

The PCR of the V3–V4 region of 16S rRNA genes and pyrosequencing was performed by Genoscreen (France, www.genoscreen.com) with GS-FLX platform (Roche). The following universal 16S rRNA primers were used for the PCR reactions: V3F (TACGGRAGGCAGCAG, 343–357 E. coli position) and V4R (GGACTACCAGGGTATCTAAT, 787–806 E. coli position).

Zhang C., Derrien M., Levenez F., Brazeilles R., Ballal S.A., Kim J., Degivry M.C., Quéré G., Garault P., van Hylckama Vlieg J.E., Garrett W.S., Doré J, & Veiga P. (2016). Ecological robustness of the gut microbiota in response to ingestion of transient food-borne microbes. The ISME Journal, 10(9), 2235-2245.

+ Open protocol

+ Expand

Transcriptome analysis of halibut tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols

cDNA libraries of the Atlantic halibut skin, GI-tract and head were prepared from pools of 6 samples per stage to obtain 5 μg of total RNA. Ribosomal RNA was depleted using RiboMinus™ Eukaryote Kit (Life Technologies, Carlsbad, USA) and following the manufacturer’s instructions. A cDNA Rapid Library Preparation Kit (Roche Life Sciences, USA) was used to construct sixteen cDNA libraries; head from stage 5 and head, skin and GI-tract from stages 7, 8 and 9A, 9B and 9C. Each library had a unique barcode and was amplified by emulsion PCR and sequenced on a GS-FLX platform (Roche Life Sciences, USA) following the manufacturers recommendations. The sequencing assigned quality scores are available at the NCBI Short Read Archive (SRA; Accession number: SRP044664).

Alves R.N., Gomes A.S., Stueber K., Tine M., Thorne M.A., Smáradóttir H., Reinhard R., Clark M.S., Rønnestad I, & Power D.M. (2016). The transcriptome of metamorphosing flatfish. BMC Genomics, 17, 413.

+ Open protocol

+ Expand

Genome Sequencing of Fimbriimonas ginsengisoli

Check if the same lab product or an alternative is used in the 5 most similar protocols

Fimbriimonas ginsengisoli Gsoil 348^T isolated from ginseng field soils was cultured with diluted modified R2A medium [4] (link). Isolated genomic DNA from pure culture of strain Gsoil 348^T was sequenced using pyrosequencing approaches on Roche GS FLX platform, which produced a total of 323,309 reads with an average length of 363 bp. The coverage of entire genome was approximately 22-fold and after initial assembly using Newbler, and 49 large contigs with an average length of 107 kb were generated. Gap closure was accomplished by multiplex PCR and PCR sequencing after the PCR products were gel-extracted. The final genome sequence was assembled using Phrap (http://www.phrap.org). The low-quality sequences were resequenced by PCR sequencing using ABI 3730 and the final sequence accuracy was 99.994%. The genome sequence data were deposited in Genbank with the accession number CP007139.

Hu Z.Y., Wang Y.Z., Im W.T., Wang S.Y., Zhao G.P., Zheng H.J, & Quan Z.X. (2014). The First Complete Genome Sequence of the Class Fimbriimonadia in the Phylum Armatimonadetes. PLoS ONE, 9(6), e100794.

+ Open protocol

+ Expand

Mitochondrial DNA Sequencing of Brassica rapa

Check if the same lab product or an alternative is used in the 5 most similar protocols

A commercial cultivar of E. sativa was used in this study. Mitochondrial DNA was isolated from 7-day-old etiolated seedlings according to Chen's methods (Chen et al., 2011), and stored at −80°C until use. Genome sequencing was performed using the GS-FLX platform (Roche, Branford, CT, USA). The reads were assembled into contigs using Newbler v.2.6. Sanger sequencing of PCR products was used to join the contigs to form the complete genome.

Wang Y., Chu P., Yang Q., Chang S., Chen J., Hu M, & Guan R. (2014). Complete Mitochondrial Genome of Eruca sativa Mill. (Garden Rocket). PLoS ONE, 9(8), e105748.

+ Open protocol

+ Expand

Coral DNA Extraction and Amplification

Check if the same lab product or an alternative is used in the 5 most similar protocols

The coral pieces were vigorously washed with TE buffer (10 mM Tris, 1 mM EDTA, pH 8.0) in a vortex mixer. The solution obtained was centrifuged for 30 s at 8944 RCF units (g) to pelletize the debris. The supernatant was transferred to another tube and centrifuged for 10 min at 15115 g. The pellet was employed for DNA isolation using a Wizard Genomic DNA Purification Kit (Promega, Madison, Wiscosin, USA), according to the manufacturer's instructions for Gram-positive bacteria. Average yield was 2 ng/µL of DNA for each sample. The DNA was amplified using a REPLI-g Midi-kit (QIAGEN, Duesseldorf, Germany), according to the manufacturer's instructions. The DNA was quantified using a Qubit Kit (Invitrogen, Carlsbad, California, USA), and the integrity was confirmed by 1% agarose gel electrophoresis. The DNA obtained ranged between 48,000 and 12,000 bp, and was sequenced by using 454 technology on a Roche GS FLX platform at the DNA Facility of Iowa State University.

Carlos C., Castro D.B, & Ottoboni L.M. (2014). Comparative Metagenomic Analysis of Coral Microbial Communities Using a Reference-Independent Approach. PLoS ONE, 9(11), e111626.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!