To determine the 3′ end of the different eRNA species transcribed from the CNS2 region, we used a previously described RNA circularization method (Couttet et al., 1997 (link); Kim et al., 2010 (link)). Briefly, 5μg of DNase treated RNA were incubated with 0.5 units of tobacco acid pyrophosphatase (Thermo Fisher) at 37°C for 1 h to expose the phosphates at the 5′ ends of all RNAs. Decapped RNA was purified and circularized with 5 units of T4 RNA ligase, which catalyzed phosphodiester bond formation between the generated 5′ phosphate and the 3′ hydroxyl group. cDNA synthesis from circularized RNA was performed with SuperScript III and random hexamers with the following program: 25°C for 5 min, 50°C for 1 h and 70°C for 15 min. After reverse transcription, 1μl of cDNA was used to amplify 5′-3′ junctions with primer pairs specifically design to that end (Supplementary Figure 1A ). For sequencing, PCR products were cloned with TOPO-TA cloning kit (Thermo Fisher, K4575J10) according to manufacturer’s instructions.
Tobacco acid pyrophosphatase
Manufactured by Thermo Fisher Scientific
Tobacco acid pyrophosphatase is an enzyme used in molecular biology and biochemistry applications. It catalyzes the hydrolysis of the pyrophosphate bond in 5'-terminal cap structures, converting them to 5'-monophosphate ends. This enzyme is commonly used in various RNA manipulation and analysis techniques.
Automatically generated - may contain errors
Lab products found in correlation
Qiaamp viral rna mini kit, by Qiagen (2 mentions)
Topo ta cloning kit, by Thermo Fisher Scientific (1 mentions)
Direct zol rna miniprep, by Zymo Research (1 mentions)
Turbo dnase 1, by Thermo Fisher Scientific (1 mentions)
Gene pulser xcell electroporation system, by Bio-Rad (1 mentions)
Hiscribe t7 high yield rna synthesis kit, by New England Biolabs (1 mentions)
Superscript 3, by Thermo Fisher Scientific (1 mentions)
Calf intestinal phosphatase, by Thermo Fisher Scientific (1 mentions)
Phusion high fidelity dna polymerase, by New England Biolabs (1 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Sequencher version 5, by Gene Codes (1 mentions)
T4 rna ligase, by Thermo Fisher Scientific (1 mentions)
3730 dna analyzer, by Thermo Fisher Scientific (1 mentions)
4 protocols using tobacco acid pyrophosphatase
1
Determination of eRNA 3' Ends
2
Synthesis and Delivery of 5' RNA Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
5′ triphosphate RNAs were generated as described above using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) and specific primers for sfRNA (forward: 5′ GATAATACGACTCACTATAGGGT GTTGTCAGGCCTGCTAGTCAGCCACAGC 3′; reverse: 5′ AGAAACCATGGATTTCCCCACACCGGCCGCCGCT 3′) and the DBSLIII mutant (forward: 5′ GATAATACGACTCACTATAGGGCCCCTCAGAGGACACTGAGTCAAAAAA 3′). 5′ monophosphate RNAs were by generated by synthesis of capped RNAs followed by treatment with Tobacco Acid Pyrophosphatase (Thermo Fisher Scientific). 5′ tri- and monophosphate RNAs were treated with the Turbo DNAse I (Thermo Fisher Scientific). RNAs were purified using Trizol LS and Direct Zol RNA MiniPrep (Zymo Research) for RNA clean up. 36 pmol of DBSLIII or sfRNA were electroporated into 2 × 106 HeLa cells in 250 µL of Ingenio electroporation solution (Mirus) using the Gene Pulser X cell Electroporation System (Bio-Rad Laboratories) following manufacturer´s instructions. 48 hr post electroporation, cells were analyzed for expression of FXR2 and BRD4 and transfection efficiency by NB as described above.
3
Determination of Viral RNA 5' and 3' UTR Sequences
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Viral RNA was isolated using a QIAamp viral RNA minikit (Qiagen), and cDNA libraries were prepared using Superscript III (Invitrogen). Sanger sequencing was performed on PCR templates generated using Phusion High-Fidelity DNA polymerase (New England BioLabs) and analyzed using Sequencher (Gene Codes) and Lasergene (DNAStar) software.
The 5′ and 3′ UTR sequences were determined as previously described (53 (link)). Briefly, viral RNA was isolated and treated with calf intestinal phosphatase (Ambion) for 1 h at 37°C to remove terminal phosphates of uncapped RNAs. Following a phenol-chloroform extraction and isopropanol precipitation, the RNA was treated with tobacco acid pyrophosphatase (Ambion) for 1 h at 37°C. After another phenol-chloroform extraction and isopropanol precipitation, the RNA was incubated with T4 RNA ligase I (Ambion) for 1 h at 37°C and then overnight at 4°C, to ligate the 5′ and 3′ ends. cDNA (Superscript III; Invitrogen) was made and used to generate an amplicon containing both the 5′ and 3′ UTR sequences, which was Sanger sequenced.
The 5′ and 3′ UTR sequences were determined as previously described (53 (link)). Briefly, viral RNA was isolated and treated with calf intestinal phosphatase (Ambion) for 1 h at 37°C to remove terminal phosphates of uncapped RNAs. Following a phenol-chloroform extraction and isopropanol precipitation, the RNA was treated with tobacco acid pyrophosphatase (Ambion) for 1 h at 37°C. After another phenol-chloroform extraction and isopropanol precipitation, the RNA was incubated with T4 RNA ligase I (Ambion) for 1 h at 37°C and then overnight at 4°C, to ligate the 5′ and 3′ ends. cDNA (Superscript III; Invitrogen) was made and used to generate an amplicon containing both the 5′ and 3′ UTR sequences, which was Sanger sequenced.
4
Zika Virus Genome Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Paraiba_01/2015 strain of ZIKV was originally isolated in the state of Paraiba (Brazil) in 2015 from a serum sample of a febrile female and was kindly provided by Pedro Vasconcelos, Instituto Evandro Chagas, Brazil. The virus initially had one passage in Vero cells in our laboratory, and a working stock of the virus (ZIKV-wt) was generated following a second passage in Vero cells grown in OptiPro medium supplemented with 2% FBS and 2 mM l -glutamine. Viral RNA was extracted from the working stock using a QIAamp viral RNA minikit (Qiagen, Valencia, CA), followed by cDNA production using SuperScript III reverse transcriptase (Invitrogen Life Technologies) and random hexamer primers. Overlapping cDNA fragments were amplified using Taq DNA polymerase and sequenced using a 3730 DNA analyzer (Applied Biosystems, Foster City, CA). To determine the 5′ and 3′ termini of the ZIKV genome, viral RNA was treated with tobacco acid pyrophosphatase (Ambion) and ligated using T4 RNA ligase (Ambion). The region flanking the junction site of the ligated RNA was amplified using a Transcriptor one-step reverse transcriptase PCR (RT-PCR) kit (Roche) and sequenced. The full-length ZIKV genome sequence was assembled and edited with Sequencher version 5.3 (Gene Codes, Ann Arbor, MI).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!