Exnase 2 enzyme

For shRNA-mediated knockdown of SGK196, LMP-puro-shRNA containing retroviruses were used. The target sequences of SGK196 shRNAs were shRNA-1: 5′-GTCTTGGATACACTTAGA-3′, and shRNA-2: 5′-AGTTACAGCATTCTACTCT-3′. For shRNA-mediated knockdown of RPN1, pLKO.1-puro-shRNA containing lentiviruses were used. The target sequences of RPN1 shRNAs were shRNA-1: 5′-GCCTTTCTCACGCTATGATTA-3′ and shRNA-2: 5′-GTGAAGCTTGCCTCTCGAAAT-3′. For encoding protein with different tags, various vectors were used. Briefly, pCMV-Tag-2b vectors for FLAG-RPN1, pEF5HA vectors for HA-SGK196, pCD513B-1 lentivirus vectors for HA-SGK196. pCD513B-1 lentivirus vectors for rescuing SGK196 (i.e. knockdown of endogenous SGK196 with SGK196 shRNA targeting 3-UTR sequence and overexpression of HA-tagged SGK196). Mutations of SGK196 were generated with mu-primers using KOD enzyme (KOD-201, TOYOBO, Japan), and Exnase® II enzyme (C215-01/02, Vazyme, Nanjing, China) was used for DNA recombination. Forward and reverse primer sequences for each N-to-Q mutation are shown in Table 1. Mutations were confirmed using automatic DNA sequencing.

pGreenPuro™ shRNA lentiviral system (System Biosciences, La Jolla, CA, USA) was used for shRNA‐mediated knockdown of Fbxo45 in the cells. The shRNA sequences are followed as below: sh1 F: 5′GATCCGGAGGAGAGATCTGCTTATGGCTCGAGCCATAAGCAGATCTCTCCTCCTTTTTG3′; sh1 R: 5′AATTCAAAAAGGAGGAGAGATCTGCTTATGGCTCGAGCCATAAGCAGATCTCTCCTCCG3′; sh2 F: 5′GATCCGGGCCTTCATTTACGTAAATTCTCGAGAATTTACGTAAATGAAGGCCCTTTTTG3′; sh2 R: 5′AATTCAAAAAGGGCCTTCATTTACGTAAATTCTCGAGAATTTACGTAAATGAAGGCCCG3′. Mutations of Fbxo45 or STEP were generated by using the KOD‐plus‐mutagenesis kit (TOYOBO, Osaka, Japan) and Exnase II enzyme (Vazyme, Nanjing, China) system according to the manufacturer's instructions. Cell transfection was performed using Hiff‐Trans™ Liposomal Transfection Reagent (YEASEN, Shanghai, China). To generate Fbxo45 knockout cell lines, The sgRNA (5′CACCGGCGATGAGAACAGCGAGGTG3′) targeting Fbxo45 was cloned into the restriction endonuclease sites BbsI in pSpCas9 (BB)‐2A‐GFP vector (PX458, Addgene). After transfection for 36 h, GFP‐positive cells were screened by flow cytometer (Becton Dickinson, Franklin Lakes, NJ, USA) and then subjected to single‐cell isolation and expansion to select the positive cell clone.