Sybr green detection chemistry

Total RNA from tissues and cells was extracted using TRIzol reagent (Invitrogen Corporation, Carlsbad, CA, USA), according to the manufacturer’s instructions, and mRNA levels were determined by real-time quantitative PCR using an ABI 7500 Fast Real-Time PCR system (Applied Biosystems, Foster City, CA, USA) with SYBR-Green Detection chemistry (Takara Bio, Inc., Shiga, Japan). All samples were measured in triplicate and the mean value was considered for comparative analysis. Quantitative measurements were determined using the 2^−ΔΔCT method with glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as an internal control.

The total RNA was isolated from the mouse livers or cultured cells using the TRIzol Reagent (Takara, TaKaRa Biotechnology, Dalian, China) according to the manufacturer’s protocol. The mRNA concentrations were measured using a Nano Drop instrument (Thermo Electron, Wilmington, NC, USA). The appropriate quantity of cDNA was generated with a PrimeScript RT reagent kit (TaKaRa, Tokyo, Japan) according to the manufacturer’s protocol. qRT-PCR was performed on the ABI 7500 Fast Real Time PCR system (Applied Biosystems, Foster City, CA, USA) using SYBR Green detection chemistry (TaKaRa, Tokyo, Japan). All samples were measured in triplicate and the mean value used for the comparative analysis. Quantitative measurements were calculated using the 2^−∆∆Ct method. GAPDH served as the housekeeping gene for the comparisons of the gene expression data. The primer sequences for the qRT-PCR analyses of the genes were selected according previous studies and are listed in Table 1.

Total RNA from tissues or cultured cells was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer's instructions. Total RNA from 200 µL serum was isolated using the miRVana PARIS kit (Ambion, Austin, TX, USA). mir-144-3p was detected with the All-in-One miRNA qPCR Kit (GeneCopoeia, Rockville, MD, USA) in a 20 µL reaction volume, using the manufacturer's protocol. Real-time quantitative PCR (qRT-PCR) was performed on the ABI 7500 Fast system (Applied Biosystems, Foster City, CA, USA). U6 RNA expression was used as the endogenous control for analysis of miR-144-3p from cells and tissues. For serum miR-144-3p analysis, isolation and assay were performed using a series of concentrations of miR-144-3p (synthesized by IDT, Coralville, IA, USA) to generate a standard curve. The absolute amount of mir-144-3p was calculated with software based on sample qRT-PCR numbers and the standard curve, and expressed as pmol/L. mRNA levels were evaluated with qRT-PCR using an ABI 7500 Fast Real Time PCR system with SYBR Green detection chemistry (TaKaRa Bio, Inc., Shiga, Japan). Expression of glyceraldehyde-3-phosphate dehydrogenase was used as the internal control. Quantitative measurements were performed using the ΔΔCt method. All samples were measured in triplicate, and mean values considered for comparative analysis.

The Tg-Nfu1 expression analysis of tissue distribution, time-course and Tg-Nfu1 silencing was conducted by qRT-PCR experiment using SYBR Green detection chemistry (TaKaRa, USA) performed in ABI 7500 Fast (Thermo Fisher Scientific, USA). The primer information for the qRT-PCR is shown in Table 1. 18SrRNA served as an internal control to normalize the Nfu1 gene for quantification. PCR reactions were carried out in a total volume of 20 μl containing 2 μl of cDNA, 2 μl of each primer (10 mM), 6 μl of RNase-free water, and 10 μl of the SYBR Green PCR Master Mix (TaKaRa, Japan). The cycling conditions were 94°C for 5 min, followed by 40 cycles of 94°C for 15 s and 60°C for 40 s. At the end of the PCR cycles, melting curve analyses were performed. The Ct value is defined as the fractional cycle number at which the fluorescence passes the fixed threshold. Each sample was analyzed in 3 triplicates.

Total RNA was isolated using RNAiso Plus (TaKaRa), and the cDNA was synthesized using a PrimeScript miRNA RT-PCR Kit (TaKaRa). A real-time quantitative PCR experiment, using SYBR Green detection chemistry (TaKaRa), was performed on a Rotor-Gene 6000 real-time quantitative PCR detection system. The primer information for the real-time quantitative PCR is shown in Table 2. RNU6B and 18S rRNA served as internal controls to normalize the miRNA or the targets for quantification, respectively. Each reaction was performed in a final volume of 20 μL, which contained 2 μL of the cDNA, 1 μL of each primer (10 μM), 6 μL of RNase-free water and 10 μL of the SYBR Green PCR Master Mix (TaKara). The amplification profile was as follows: denaturation at 94 °C for 5 min, followed by 40 cycles of 94 °C for 15 s, 60 °C for 30 s and 70 °C for 30 s. At the end of the PCR cycles, melting curve analyses were performed. The Ct value is defined as the fractional cycle number at which the fluorescence passes the fixed threshold. Each sample was analyzed in triplicate.

Total RNA was isolated from cells according to the instructions of a TaKaRa Mini BEST Universal RNA Extraction Kit, and the primer sequences used were as follows: sense: 5'‐GGTTACAGAGGAGGGAGCAGAA‐3' and antisense: 5'‐GGGTGATTACAATGGAACTCTTCA‐3'. The amplification was monitored on an ABI Prism 7500 real‐time PCR apparatus (Applied Biosystems) using SYBR Green detection chemistry (TaKaRa). The cycling conditions were as follows: 95°C for 30 seconds followed by 40 cycles of 95°C for 5 seconds and 60°C for 34 seconds. Analysis of the relative fold change in gene expression was performed with the comparative cycle threshold method (2^−ΔΔCt). All samples were assessed in triplicate.